texts
list | meta
dict | scores
list | avg_score
float64 0
0.2
| num_sents
int64 5
5
|
|---|---|---|---|---|
[
"Swimming at the 1952 Summer Olympics – Women's 100 metre backstroke\n\nThe women's 100 metre backstroke event at the 1952 Olympic Games took place on 29–31 July at the Swimming Stadium. ",
"This swimming event used the backstroke. ",
"Because an Olympic-size swimming pool is 50 metres long, this race consisted of two lengths of the pool.",
"\n\nMedalists\n\nResults\n\nHeats\nEight fastest swimmer advanced to the finals.",
"\n\nHeat 1\n\nHeat 2\n\nHeat 3\n\nFinal\n\n{| class=\"wikitable sortable\" style=\"text-align:center\"\n! ",
"Rank !! ",
"Athlete !!",
"Country !! ",
"Time || Notes\n|-\n| || Joan Harrison ||align=left| ||1:14.3 || '''|-\n| || Geertje Wielema ||align=left| ||1:14.5 || |-\n| || Jean Stewart ||align=left| ||1:15.8 || |-\n|-\n| 4 || Joke de Korte ||align=left| ||1:15.8 || |-\n| 5 || Barbara Stark ||align=left| ||1:16.2 || |-\n| 6 || Gertrud Herrbruck ||align=left| ||1:18.0 || |-\n| 7 || Margaret McDowell ||align=left| ||1:18.4 || |-\n| || Ria van der Horst ||align=left| ||DSQ || |}Key''': DSQ = Disqualified\n\nReferences\n\nExternal links\nWomen 100m Backstroke Swimming Olympic Games 1952 Helsinki (FIN), retrieved 2013-12-30\n\nWomen's backstroke 100 metre\nCategory:1952 in women's swimming\nCategory:Women's events at the 1952 Summer Olympics"
] |
{
"pile_set_name": "Wikipedia (en)"
}
|
[
0,
0,
0,
0,
0,
0,
0,
0,
0.009943181818181818
] | 0.001105
| 5
|
[
"Copyright (c) 2015 Baptist Press. ",
"Reprinted from Baptist Press (www.baptistpress.com), news service of the Southern Baptist Convention.",
"\nThe original story can be found at http://www.bpnews.net/43133/pray-fervently-for-iraqis-moore-says\n\n'Pray fervently' for Iraqis, Moore says\n\nWASHINGTON (BP) -- The Southern Baptist Convention's lead ethicist has commended President Obama's authorization of targeted airstrikes and humanitarian aid to assist members of Iraqi religious minorities threatened by Islamic militants.",
"\n\nUnited States military attacks since the president's Aug. 7 authorization reportedly have helped repel advances by the Islamic State of Iraq and Syria (ISIS) in the northern part of the Middle Eastern country.",
"\n\nObama also took action Aug. 8 that advocates of global religious freedom had said would help in Iraq. ",
"He signed into law the Near East and South Central Asia Religious Freedom Act, which authorizes the president to appoint a special envoy for the promotion of religious liberty in Iraq and other countries in the region.",
"\n\nAfter Obama's Aug. 7 announcement, Russell D. Moore, president of the Ethics & Religious Liberty Commission, said Obama \"is right to take action to protect religious minorities, including Christians, in Iraq from ISIS.\"",
"\n\n\"He has my prayers,\" Moore said of the president in an Aug. 8 written statement. \"",
"Those families stranded on a mountaintop, fleeing torture, rape and beheading, deserve justice and compassion.",
"\n\n\"As Christians, we should pray for the president and our military leaders to wisely administer the sword of justice (Romans 13:1-3),\" Moore said. \"",
"As part of the global body of Christ, we must also pray fervently for our persecuted brothers and sisters in Iraq and across the Middle East (Hebrews 13:3).\"",
"\n\nObama authorized the actions as ISIS' campaign of terror spread further in northern Iraq. ",
"The Sunni Muslim militants had already emptied Mosul, Iraq's second largest city, of Christians before taking its bloody offensive to other cities, sending many people into exile. ",
"Their advance on Sinjar resulted in as many as 50,000 people fleeing for safety to the Sinjar Mountains. ",
"Most were Yazidis, who make up a minority religious sect, but some reportedly were Christians. ",
"The terrorists executed some Yazidis and enslaved some Yazidi women, according to reports.",
"\n\nIn announcing his action, Obama said the authorization of the two operations was to avert \"a potential act of genocide.\" ",
"He also pointed to ISIS' advance toward the city of Erbil as a reason. ",
"Erbil is a home to U.S. diplomats and civilians who work at the consulate, as well as American military advisers.",
"\n\n\"When we face a situation like we do on that mountain -- with innocent people facing the prospect of violence on a horrific scale, when we have a mandate to help -- in this case, a request from the Iraqi government -- and when we have the unique capabilities to help avert a massacre, then I believe the United States of America cannot turn a blind eye,\" the president said Aug. 7. \"",
"We can act, carefully and responsibly, to prevent a potential act of genocide. ",
"That's what we're doing on that mountain.\"",
"\n\nHe added, \"Earlier this week, one Iraqi in the area cried to the world, 'There is no one coming to help.' ",
"Well today, America is coming to help.\"",
"\n\nObama said U.S. combat troops would not return to Iraq to fight. ",
"He \"will not allow the United States to be dragged into fighting another war in Iraq,\" the president said.",
"\n\nOn Aug. 9, Obama told reporters that airstrikes already had destroyed ISIS arms and equipment outside Erbil, and two airdrops had succeeded in providing food and water to those on Mount Sinjar. ",
"He also said the United States had increased its military aid to the Kurdish forces fighting ISIS in northern Iraq.",
"\n\nThe new law signed by Obama providing authorization of a special envoy for religious liberty in the Near East and South Central Asia is designed to aid faith practitioners in such countries as Iraq, Egypt, Iran, Pakistan and Syria. ",
"Christians and adherents of other religious faiths increasingly are targets of repression and violence in those regions. ",
"The existence of entire religious movements is threatened in some areas, most notably Iraq and Egypt.",
"\n\nRep. Frank Wolf, R.-Va., ",
"sponsor of the special envoy bill, welcomed Obama's authorization of airstrikes and aid in Iraq as a \"positive first step,\" but said the president needs to do more. ",
"Wolf repeated appeals he had made to Obama in a series of speeches to the House of Representatives. ",
"Among his recommendations, Wolf urged the president to name a senior administration official to supervise response to the ISIS massacre and to provide assistance to the Kurdish government.",
"\n\n\"In addition to acknowledging that genocide is taking place, we must also be mindful of the threat to our national security by the thousand or more foreign fighters -- including more than a hundred Americans -- who have linked up with ISIS, and can travel back and forth to their home countries with ease,\" Wolf said in an Aug. 8 written statement. \"",
"This is one of the most significant national security threats in years. ",
"The administration must do everything possible to protect the American people from these threats, including seeking any legislative changes to prevent radicalized westerners from threatening the homeland.\"",
"\n\nThree days of U.S. strikes by fighter jets and drones appear to have helped curb ISIS' progress toward Erbil and weaken its hold on the region around the Sinjar Mountains, American officials said Monday (Aug. 11), according to The Wall Street Journal. ",
"The latest airstrikes Aug. 10 destroyed several vehicles in a caravan planning to attack Kurdish forces, the newspaper reported. ",
"The Kurds were able to retake two towns captured by ISIS, according to the report. ",
"Four humanitarian airdrops have occurred in the mountains.",
"\n\nThe International Mission Board and Baptist Global Response (BGR), an IMB ministry partner, have asked Southern Baptists to help provide humanitarian relief to Iraqi refugees. ",
"BGR representatives are seeking to aid the reportedly 200,000 internally displaced Iraqis who have left their homes in the face of the ISIS threat.",
"\n\nSouthern Baptists and others may help Iraqi refugees by donating to the IMB general relief fund or by texting imbrelief to 80888, which will donate $10 to that fund.* ",
"To give through BGR, visit gobgr.org or text bgr to 80888.",
"\n\n*$10 will be added to your mobile phone bill or deducted from your prepaid balance. ",
"Message and data rates may apply. ",
"Must have account holder permission to donate. ",
"Terms: igfn.org/t. ",
"With reporting by Don Graham, an IMB senior writer. ",
"Tom Strode is Washington bureau chief for Baptist Press, the Southern Baptist Convention's news service. ",
"BP reports on missions, ministry and witness advanced through the Cooperative Program and on news related to Southern Baptists' concerns nationally and globally. ",
"Get Baptist Press headlines and breaking news on Twitter (@BaptistPress), Facebook (Facebook.com/BaptistPress) and in your email (baptistpress.com/SubscribeBP.asp).",
"\n\nFormed in 1946 by the Southern Baptist Convention, and supported with Cooperative Program funds, Baptist Press (BP) is a daily (M-F) international news wire service. ",
"Operating from a central bureau in Nashville, Tenn., BP works with four partnering bureaus (Richmond, Va.; Atlanta, Ga.; Nashville, Tenn.; and Washington, D.C.), as well as with a large network of contributing writers, photographers and editorial providers, to produce BP News."
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0.029411764705882353,
0.019801980198019802,
0.013157894736842105,
0.009478672985781991,
0.009615384615384616,
0,
0.01809954751131222,
0.011904761904761904,
0,
0.006711409395973154,
0,
0.010869565217391304,
0,
0.009523809523809525,
0.010526315789473684,
0.011111111111111112,
0.008130081300813009,
0.014084507042253521,
0.008849557522123894,
0,
0,
0,
0,
0,
0,
0,
0.01020408163265306,
0.008695652173913044,
0,
0,
0,
0.037037037037037035,
0,
0.02,
0.010638297872340425,
0.005681818181818182,
0,
0,
0.011811023622047244,
0,
0.012048192771084338,
0,
0.016853932584269662,
0.013605442176870748,
0,
0,
0,
0,
0,
0,
0.019230769230769232,
0.02857142857142857,
0.018518518518518517,
0.018292682926829267,
0.017857142857142856,
0.007220216606498195
] | 0.007992
| 5
|
[
"705 F.2d 451\nAttiav.",
"I. R. S.\n82-1063\nUNITED STATES COURT OF APPEALS Sixth Circuit\n8/2/82\n\n1\nE.D.Mich.",
"\n\nAFFIRMED\n"
] |
{
"pile_set_name": "FreeLaw"
}
|
[
0,
0.024691358024691357,
0
] | 0.00823
| 5
|
[
"Q:\n\nIs there a way to open up a html file in a browser from a .NET application?",
"\n\nI have a HTML file I want to open in a browser. ",
"I want to open this using a .NET application. ",
"\nBeing more specific, I want to open this file in a browser each time say the user inputs a variable value ='abc' say. ",
"\nI'm using C# in .NET\nIs there anyway to do this?",
"\nPlease let me know.",
"\nThanks.",
"\n\nA:\n\nProcess.",
"Start(nameOfHtmlFile) will launch the default browser.",
"\n\nA:\n\nThe WebBrowser Class lets you load html files or you can use... System.",
"Diagnostics.",
"Process.",
"Start(\"IEXPLORE.EXE\", \"C:\\FilePath.html\");\n\nA:\n\nFor Further Reference : The answer to the question can be found here : http://social.msdn.microsoft.com/Forums/en-US/netfxjscript/thread/e43012b2-8d72-423a-99bd-c6a4ef358077\nIt uses MSScriptControl and the JS code can just be added into the .NET application as shown. ",
"The class name shown should be ScriptControl, not ScriptControlClass.",
"\nThanks,\nThothathri\n\n"
] |
{
"pile_set_name": "StackExchange"
}
|
[
0,
0,
0,
0.008403361344537815,
0,
0,
0,
0,
0,
0.012987012987012988,
0,
0,
0.0031645569620253164,
0.014492753623188406,
0
] | 0.002603
| 5
|
[
"Mr. Speaker, as I already said in answer to a previous question, the fact of the matter is that the coalition opposition has been calling political staffers to appear before committees and then bullying, intimidating and attacking them and demeaning them.",
"\n\nQuite simply, we will no longer tolerate that type of abuse of our staff. ",
"We will uphold the precedent and the principle of ministerial accountability and responsibility. ",
"Our ministers will be appearing at committee. ",
"I would think that would be applauded by the opposition.",
"\n\nMr. Speaker, it is a complete fabrication. ",
"It is that party and that government that is the bully. ",
"It is not the opposition. ",
"It is that government and that Prime Minister.",
"\n\nThe policy to protect Dimitri Soudas contravenes the principles of political sovereignty. ",
"The Conservatives are choosing which minister to send, even though that minister may not be from the same department as the invited employee.",
"\n\nHow can the Minister of Natural Resources appear before one committee instead of his assistant and yet refuse to appear before another committee?",
"\n\nMr. Speaker, on this side we believe in accountability and we believe in the principle of ministerial responsibility. ",
"That is why we will stand by our staff. ",
"We will no longer allow them to be abused by the opposition coalition at committee, which wants nothing but to intimidate, attack and demean them.",
"\n\nCabinet ministers will appear at committee and they will answer questions from the opposition, as is their right and their responsibility.",
"\n\nMr. Speaker, the Conservatives white collar crime bill fails to address many financial crimes, which ruined the lives of honest Canadians. ",
"The government is doing too little, too late. ",
"We just need to ask the victims of Earl Jones.",
"\n\nWhere is stock manipulation mentioned in the bill? ",
"Nowhere. ",
"The omission of large scale mortgage fraud from mandatory minimums in the bill means no response to the massive mortgage fraud in Alberta.",
"\n\nMr. Speaker, I cannot tell the House how pleased I am that the Liberal Party has discovered the justice agenda. ",
"It is only once every four or five months that we get a question from Liberal members on this subject.",
"\n\nIt is true that we have introduced a bill on white collar crime that sends out the right message. ",
"People who are victims of white collar crime are victims as much as anybody who gets beaten up in an alley. ",
"That is why we have introduced Bill C-21.",
"\n\nFor once, I would hope the Liberal Party would stop its equivocation, get on board and start to support victims and law-abiding Canadians for a change.",
"\n\nA question once every four or five months, Mr. Speaker? ",
"We barely sit once every four or five months because of prorogation.",
"\n\nThat minister did not mention mortgage fraud in his answer. ",
"I can understand why the Conservative Party does not want to bring it up.",
"\n\nWill the minister recommend the necessary amendments in his white collar crime bill, or will he continue to only provide lip service to the victims of crime? ",
"When will he do his job to present responsive and effective legislation, or will we over here have to do it ourselves?",
"\n\nMr. Speaker, today the OECD released its spring 2010 economic outlook. ",
"According to the report, the Canadian economy is rebounding vigorously, helped by a recovering trade sector and policy measures.",
"\n\nThe OECD has also pointed to and praised our government's economic action plan, with measures like the infrastructure projects under way across Canada and our proposal to make Canada a tariff-free zone for manufacturers.",
"\n\nMr. Speaker, the OECD expects this year and next year that Canada will be the fastest growing economy in the entire G7 and also beat the OECD forecasts for economic growth by a very wide margin. ",
"Clearly our economic action plan is working.",
"\n\nHowever, members should not believe me. ",
"Let me read what the report said. ",
"Listen to what one senior OECD official said about the good work on the Canadian economy, “I think Canada looks good - it shines, actually. ",
"Canada could even be considered a safe haven”. ",
"Is there any wonder why Canada has the best finance miniser in the world?",
"\n\nMr. Speaker, the cost of holding the G8 and G20 summits in Canada are becoming incomprehensible. ",
"In March Canadians were told that it would cost $179 million to hold these two meetings. ",
"Now, only two months later, that price is $930 million, five times the original amount. ",
"With the government in deficit, that means another $1 billion will be added to our national debt.",
"\n\nCould the government explain to Canadians why two meetings over four days will cost taxpayers nearly $1 billion?",
"\n\nMr. Speaker, the member well knows that $179 million was never the original estimate. ",
"The original estimate has been $930 million.",
"\n\nThis is a plan that has been put together by the security experts. ",
"These are necessary costs in order to secure the safety of visiting heads of nations. ",
"We have that responsibility and we will carry it out.",
"\n\nMr. Speaker, that is the same minister who costed the two-for-one bill at $90 million and 24 hours later said that it was $2 billion.",
"\n\nThe irony is that one of the main topics at the G20 will be how to get government spending under control. ",
"I am sure one of our lessons will be not to hold the G8 or G20.",
"\n\nFrom the two locations to the locking down of Canada's busiest city in a critical tourist season, the government's handling of this event has been sloppy and irresponsible. ",
"In the end, it is Canadians who will be left paying for Conservative errors.",
"\n\nCould the government explain why these meetings will end up costing more than double any previous G8, G20 summits?",
"\n\nMr. Speaker, I do not think we have to take lessons from the Socialists on how to budget. ",
"The member for Toronto Centre knows that full well. ",
"He has indicated, on more than one occasion, that those are not people to take lessons from.",
"\n\nAll costs have been budgeted and are on target. ",
"We have always stated that overall costs will be finalized at the end of both of these summits. ",
"Putting two of these summits together, back to back, has been unprecedented. ",
"We have relied on the experts to give us the costs. ",
"We are prepared to meet those costs in order to meet the security interests and the safety of heads of nations.",
"\n\nMr. Speaker, the Conservative government says it does not wish to reopen the abortion debate. ",
"However, it was Conservative members who introduced bills to restrict access to abortion and it is the Conservative government that is proposing to stop funding abortion abroad. ",
"Even Msgr. ",
"Ouellet stated that he was prompted to make a public statement because the Conservative government had reopened the debate.",
"\n\nWill the government admit that it has reopened the debate on abortion to satisfy the religious fundamentalists of the Conservative Party?",
"\n\nRona AmbroseMinister of Public Works and Government Services and Minister for Status of Women\n\nMr. Speaker, as the Prime Minister has indicated this week and as our government has reiterated many times, this government has no intention of reopening this issue and we have no intention of introducing the supporting legislation on the issue."
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0.00392156862745098,
0,
0,
0.021739130434782608,
0,
0.022222222222222223,
0,
0,
0,
0.010869565217391304,
0,
0,
0.008333333333333333,
0,
0,
0,
0.0070921985815602835,
0,
0.021739130434782608,
0,
0,
0,
0.02631578947368421,
0.00980392156862745,
0,
0,
0.024390243902439025,
0.006535947712418301,
0.017241379310344827,
0,
0,
0.0136986301369863,
0,
0,
0.0273972602739726,
0,
0.0045045045045045045,
0.015228426395939087,
0,
0,
0,
0.007142857142857143,
0,
0,
0.020202020202020204,
0,
0,
0,
0,
0.011363636363636364,
0,
0,
0,
0,
0.007407407407407408,
0.009259259259259259,
0,
0,
0,
0.017241379310344827,
0.010869565217391304,
0,
0,
0,
0,
0,
0,
0,
0.010416666666666666,
0,
0,
0,
0.007194244604316547,
0.0029239766081871343
] | 0.004663
| 5
|
[
"Jerome Schwartz\n\nJerome Schwartz is an American television and film writer and producer.",
"\n\nHe is well known for his work on the ABC fantasy series Once Upon a Time; as well as for its spin-off Once Upon a Time in Wonderland.",
"\n\nLife and career\nHe grew up in Bellingham, Washington. ",
"He attended Whitman College, graduating with a double major in theatre and English literature. ",
"He traveled the world after graduation, before settling in Los Angeles. ",
"He started off as a clerical assistant on the NBC series The Office. ",
"His girlfriend at the time passed his resume to producers at CBSs Cold Case, and he was hired as a writers production assistant. ",
"He was later promoted to research assistant.",
"\n\nIn 2010, Schwartz co-wrote his first film with director Cullen Hoback, Friction. ",
"A film that blurs the line between fiction and documentary. ",
"He'd go on to write for short lived series Chase and Zero Hour.",
"\n\nOnce Upon a Time\nAfter Zack Estrin was hired as showrunner for the ABC series Once Upon a Times new spinoff Once Upon a Time in Wonderland by Edward Kitsis, Jane Espenson and Adam Horowitz; he brought Schwartz on, since establishing a rapport with him on Zero Hour. ",
"When Wonderland wasn't renewed for a second season; Schwartz became the only crew member to shift over to the mother series, joining its fourth year. ",
"Schwartz has contributed some notable episodes of the series such as: \"Rocky Road,\" \"Smash the Mirror,\" \"The Broken Kingdom,\" and \"Birth.\"",
"\n\nThe Fix\nSchwartz wrote one episode of The Fix entitled: \"The Wire\"\n\nEmergence\nSchwartz wrote one episode of Emergence entitled: \"No Outlet\"\n\nReferences\n\nExternal links\n\nCategory:American television writers\nCategory:Male television writers\nCategory:Living people\nCategory:Year of birth missing (living people)\nCategory:Place of birth missing (living people)"
] |
{
"pile_set_name": "Wikipedia (en)"
}
|
[
0.011363636363636364,
0.007407407407407408,
0,
0.010526315789473684,
0,
0.014492753623188406,
0,
0,
0.024096385542168676,
0,
0.015873015873015872,
0.022388059701492536,
0.013333333333333334,
0.007246376811594203,
0.002793296089385475
] | 0.008635
| 5
|
[
"Q:\n\nMatch any number (or negitive number) except '-0'\n\nI have the followin RegEx to match any number between 1 and 4 digits in length, with a - character if so desired.",
"\n^[-]?\\d{1,4}$\n\nHowever, I'd like to exclude from the list of possible matches -0. ",
" I've tried the following, but it seems to break everything.",
"\n^[-]?(?!-0)\\d{1,4}$\n\nHow can I achieve my goal?",
"\n\nA:\n\nJust put the excluding group before :\n^(?!-0)-?\\d{1,4}$\n\nNote that you don't have to put the minus sign between brackets.",
"\n\n"
] |
{
"pile_set_name": "StackExchange"
}
|
[
0,
0,
0,
0,
0,
0
] | 0
| 5
|
[
"Before a fire demolished their town, Rowdy Shaw and Shanna Shaw had planned to host nine guests for Thanksgiving at their new home, off Lucky John Road in Paradise, Calif. The Shaws had moved into the house just four months earlier, to be close to the community’s resources for their daughter, Chelsea, who has Down syndrome, and close to Mr. Shaw’s employer, the Pacific Gas and Electric Company.",
"\n\nLike so many families, they thought about what they needed to stock up on, and what chores had to get done before their guests arrived. ",
"They looked forward to sitting down with bellies full of turkey and watching “National Lampoon’s Christmas Vacation,” as they do every year. ",
"But two weeks before Thanksgiving, they joined a caravan of evacuees leaving town in buses and cars, with a fire raging around them.",
"\n\nTheir new home burned to the ground. ",
"On Thanksgiving, instead of hosting dinner, the family left their room at the Residence Inn in nearby Chico to fill out paperwork with FEMA, apply for new social security cards and look for a deed to their home. ",
"Like thousands of other displaced families, their annual traditions had been thrown into disorder, but they found some warmth."
] |
{
"pile_set_name": "OpenWebText2"
}
|
[
0.017632241813602016,
0,
0,
0,
0,
0.0047169811320754715,
0
] | 0.003193
| 5
|
[
"Title\n\nAuthors\n\nDocument Type\n\nArticle\n\nPublication Date\n\n9-1993\n\nAbstract\n\nThis paper describes the application of reverse-burn gasification (the ChemChar process) for the treatment of mixed wastes, which are wastes containing both hazardous organic matter and radionuclides. ",
"The specific wastes studied consisted of ion-exchange resins to which were bound radioactive technetium-99m and non-radioactive surrogates for waste radionuclides. ",
"It was shown that with reverse-burn gasification the resins could be dewatered and converted to inert char and innocuous gas products with complete retention of the radionuclides. ",
"The residual char can be mixed with Portland cement and water to produce a poorly leachable aggregate in concrete. ",
"An approximately 20-fold reduction in volume of the original wet resin can be accomplished with a reverse-burn gasification followed by a forward burn to produce a low-volume, poorly leachable slag."
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0,
0,
0,
0,
0
] | 0
| 5
|
[
"{\n \"usingComponents\": {\n \"calendar\": \"plugin://calendar/calendar\"\n }\n}"
] |
{
"pile_set_name": "Github"
}
|
[
0
] | 0
| 5
|
[
"Greatest Sins\n\nProduct Notes\n\nA band that was conceived in the minds of lead vocalist- Shellhammer and rhythm guitarist- Shock. ",
"Other members include lead guitarist- Dedd Sexxxi, bassist- Lady Vengeance, and keyboardist- Sister Mary Murders. '",
"Greatest Sins' was released on January 31, 2009. ",
"The release is a celebration of the band's sixth anniversary, and a real treat for fans. ",
"The disc features digital re-recordings of tracks selected from band and fan favorites, as well as rare tracks, and 2 killer new songs. ",
"There is 16 tracks total, for a running time of 1 hour and 13 minutes!",
"\n\nA band that was conceived in the minds of lead vocalist- Shellhammer and rhythm guitarist- Shock. ",
"Other members include lead guitarist- Dedd Sexxxi, bassist- Lady Vengeance, and keyboardist- Sister Mary Murders. '",
"Greatest Sins' was released on January 31, 2009. ",
"The release is a celebration of the band's sixth anniversary, and a real treat for fans. ",
"The disc features digital re-recordings of tracks selected from band and fan favorites, as well as rare tracks, and 2 killer new songs. ",
"There is 16 tracks total, for a running time of 1 hour and 13 minutes!"
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0,
0.02608695652173913,
0,
0,
0,
0,
0,
0.02608695652173913,
0,
0,
0,
0
] | 0.004348
| 5
|
[
"<?",
"php\n\nnamespace App\\Repositories\\Backend\\Settings;\n\nuse App\\Exceptions\\GeneralException;\nuse App\\Models\\Settings\\Setting;\nuse App\\Repositories\\BaseRepository;\nuse Illuminate\\Support\\Facades\\Storage;\n\n/**\n * Class SettingsRepository.",
"\n */\nclass SettingsRepository extends BaseRepository\n{\n /**\n * Associated Repository Model.",
"\n */\n const MODEL = Setting::class;\n\n /**\n * Site Logo Path.",
"\n *\n * @var string\n */\n protected $site_logo_path;\n\n /**\n * Favicon path.",
"\n *\n * @var string\n */\n protected $favicon_path;\n\n /**\n * Storage Class Object.",
"\n *\n * @var \\Illuminate\\Support\\Facades\\Storage\n */\n protected $storage;\n\n /**\n * Constructor.",
"\n */\n public function __construct()\n {\n $this->site_logo_path = 'img'.",
"DIRECTORY_SEPARATOR.'logo'.",
"DIRECTORY_SEPARATOR;\n $this->favicon_path = 'img'.",
"DIRECTORY_SEPARATOR.'favicon'.",
"DIRECTORY_SEPARATOR;\n $this->storage = Storage::disk('public');\n }\n\n /**\n * @param \\App\\Models\\Settings\\Setting $setting\n * @param array $input\n *\n * @throws \\App\\Exceptions\\GeneralException\n *\n * @return bool\n */\n public function update(Setting $setting, array $input)\n {\n if (!",
"empty($input['logo'])) {\n $this->removeLogo($setting, 'logo');\n\n $input['logo'] = $this->uploadLogo($setting, $input['logo'], 'logo');\n }\n\n if (!",
"empty($input['favicon'])) {\n $this->removeLogo($setting, 'favicon');\n\n $input['favicon'] = $this->uploadLogo($setting, $input['favicon'], 'favicon');\n }\n\n if ($setting->update($input)) {\n return true;\n }\n\n throw new GeneralException(trans('exceptions.backend.settings.update_error'));\n }\n\n /*\n * Upload logo image\n */\n public function uploadLogo($setting, $logo, $type)\n {\n $path = $type == 'logo' ? ",
"$this->site_logo_path : $this->favicon_path;\n\n $image_name = time().$logo->getClientOriginalName();\n\n $this->storage->put($path.$image_name, file_get_contents($logo->getRealPath()));\n\n return $image_name;\n }\n\n /*\n * remove logo or favicon icon\n */\n public function removeLogo(Setting $setting, $type)\n {\n $path = $type == 'logo' ? ",
"$this->site_logo_path : $this->favicon_path;\n\n if ($setting->$type && $this->storage->exists($path.$setting->$type)) {\n $this->storage->delete($path.$setting->$type);\n }\n\n $result = $setting->update([$type => null]);\n\n if ($result) {\n return true;\n }\n\n throw new GeneralException(trans('exceptions.backend.settings.update_error'));\n }\n}\n"
] |
{
"pile_set_name": "Github"
}
|
[
0,
0,
0.02040816326530612,
0,
0.010526315789473684,
0.009900990099009901,
0.008620689655172414,
0,
0,
0,
0.03333333333333333,
0.014044943820224719,
0,
0,
0,
0
] | 0.006052
| 5
|
[
"You now have the option to add a 4cm white border around your image. ",
"Adding a white border will not change the overall size of your print.",
"\n\nI recommend that you do not add on a white border if your frame already has a mat insert.",
"\n\nIf you are ordering framed prints, then I recommend that you add a white border as my frames do not come with mat inserts.",
"\n\nSizes\n\nI offer sizes A3, A2, 50cm x 70cm, 60cm x 90cm, A1, 70cm x 100cm & A0. ",
"Not all of my prints go up to the larger sizes. ",
"The available sizes are displayed in the drop-down menu of the product.",
"\n\nIf you're using the Kmart 61cm x 91.5cm frame, you can order the 60cm x 90cm print, then pop in the additional information box on checkout that you'd like me to re-size to fit this frame.",
"\n\nFraming (Australian customers only)\n\nAll frames are made from a high quality sustainable timber in either an oak, black or white finish. ",
"Frame dimensions are 2cm width x 3cm depth (2cm width x 4cm depth on frames over 100cm). ",
"Frames are all fitted with a 3mm shinkolite acrylic (higher clarity than glass).",
"\n\nPlease note that my frames do not come with mat inserts, so if you'd like a 4cm white border around your print, then please select 'yes' for white border.",
"\n\nFrame choices below (oak, black or white)\n\nWhen purchasing from Love Your Space you are supporting a small business based in Australia."
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0,
0,
0,
0,
0.0125,
0,
0,
0.005291005291005291,
0,
0,
0,
0,
0
] | 0.001369
| 5
|
[
"Stock photo / Stock vector illustration: Vector Illustration of a Papyrus Tittle Scroll Tag with Rolled and Arched Edges. ",
"Set of five sizes Small Medium Large and two Extra Large. ",
"All elements neatly on well-defined Layers and Groups"
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0,
0.017241379310344827,
0.03773584905660377
] | 0.018326
| 5
|
[
"Targeting MIC Shedding to Revive Host NKG2D-mediated Immune Response in Prostate Cancer NKG2D-mediated tumor rejection has been well demonstrated in experimental animal models. ",
"In humans, the system is not effective due to tumor shedding of the human NKG2D ligands, the MHC class I chain-related family of molecules MICA and MICB (collectively termed MIC). ",
"Strong evidence has demonstrated that tumor shedding of MIC results in multiple negative effects on NKG2D-mediated immunity and suggested that it is one of the mechanisms by which tumors escape immune destruction and progress. ",
"The mechanisms by which tumors shed MIC are not fully understood, although a diverse group of enzymes have been shown to be involved. ",
"However, the functional complexity of these enzymes may not make it clinically feasible to use inhibitors to target MIC shedding for cancer therapy. ",
"Our long-term goal is to define optimal strategies to inhibit MIC shedding and ultimately to harness NKG2D-mediated anti-tumor immunity as potential therapies for prostate cancer and other MIC-positive tumors as well. ",
"In our accomplished studies, we have shown that preventing MIC shedding resulted in prostate tumor rejection in vivo. ",
"Recently we have defined an 11-aa motif (shedding motif) in the a3 domain of MIC that is critical for regulating MIC shedding and generated a single chain antibody (scFv) that inhibits MIC shedding by targeting the shedding-motif. ",
"In this proposal, we specifically hypothesize that targeting MIC shedding in association with amplification of NKG2D- mediated immune responses by IL-15 agonists can attenuate prostate cancer progression. ",
"The experimental focus of proposal is to elicit the mechanisms by which the 11-aa shedding-motif is a therapeutic target and to evaluate the therapeutic impacts of targeting MIC shedding with our novel antibody in association with amplification of NKG2D-mediated immune response. ",
"Our specific Aims are: 1) to elucidate the mechanisms by which the shedding-motif regulating MIC shedding and is a therapeutic target to inhibit MIC shedding; 2) to define the impact of persistent tumor cell surface MIC stimulation on NKG2D function in NK cells and the impact of IL-15 agonist in this context; 3) To evaluate the therapeutic impact of antibody-mediated inhibition of MIC shedding combined with IL-15 agonists in prostate tumorigenesis and progression. ",
"If we show that inhibiting MIC shedding with our antibody in combination of IL-15 agonist can successfully harness host anti- tumor immune responses in animal models, the treatment strategy can be readily translated into clinical trials for prostate cancer. ",
"In addition, the reagents can be further engineered for the clinical application. ",
"Furthermore, as shedding of MIC was evident in many malignancies, the outcomes of this proposed research will have broad clinical implications for cancer therapy. ",
"PUBLIC HEALTH RELEVANCE: Targeting MIC shedding to revive host NKG2D-mediated immune response in prostate cancer In this proposal, we specifically hypothesize that targeting MIC shedding in association with amplification of NKG2D-mediated immune responses by IL-15 agonists can attenuate prostate cancer progression. ",
"The experimental focus of proposal is to elicit the mechanisms by which our identified shedding-motif is a therapeutic target and to evaluate the preventive and therapeutic impacts of targeting MIC shedding with our novel antibody in combination with amplification of NKG2D-mediated immune response by the IL-15 agonist. ",
"The proposed study will elucidate the mechanisms of targeting MIC shedding and the MIC-NKG2D-based dynamic interaction of tumor cells with the immune systems. ",
"Moreover, this proposed study will validate the effectiveness our novel antibody for prostate cancer prevention and therapy using our generated novel double transgenic animal models. ",
"Furthermore, as shedding of MIC was evident in many malignancies, the outcomes of this proposed research will have broad clinical implications for epithelial cancer therapy."
] |
{
"pile_set_name": "NIH ExPorter"
}
|
[
0.005649717514124294,
0.011111111111111112,
0.004405286343612335,
0.007462686567164179,
0.006711409395973154,
0.0045871559633027525,
0.00847457627118644,
0.008658008658008658,
0.00975609756097561,
0.0035714285714285713,
0.008528784648187633,
0.003875968992248062,
0,
0.006134969325153374,
0.0031545741324921135,
0.003115264797507788,
0.012578616352201259,
0,
0.005780346820809248
] | 0.005977
| 5
|
[
"New \"On Panel Activate\" event akin to \"On Page Load\"\n\nAs rich web applications increasingly use AJAX-type interactions to load portions of the page dynamically, the \"on page load\" event becomes less and less useful as a trigger for events specific to a particular screen region.",
"\n\nJustinmind's \"Panels\" are a fine way to simulate these interactions, but would be even more powerful and flexible if there was an \"On Panel Activate\" event trigger akin to \"On Page Load\" (and possibly an \"On Panel Deactivate\" to match it, akin to \"On Page Unload\".)",
"\n\nI know that I can add \"on click\" and other events to the components that use \"Set Active Panel\" to trigger the panel changes, but that leads to a lot of duplication of effort and difficulty in maintaining a complex prototype.",
"\n\nBetter would be to detect when a panel activates and perform the initialization or other actions pertinent to that panel becoming active."
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0,
0,
0,
0
] | 0
| 5
|
[
"Researching evaluation influence: a review of the literature.",
"\nThe impact of an evaluation is an important consideration in designing and carrying out evaluations. ",
"Evaluation influence is a way of thinking about the effect that an evaluation can have in the broadest possible terms, which its proponents argue will lead to a systematic body of evidence about influential evaluation practices. ",
"This literature review sets out to address three research questions: How have researchers defined evaluation influence; how is this reflected in the research; and what does the research suggest about the utility of evaluation influence as a conceptual framework. ",
"Drawing on studies that had cited one of the key evaluation influence articles and conducted original research on some aspect of influence this article reviewed the current state of the literature toward the goal of developing a body of evidence about how to practice influential evaluation. ",
"Twenty-eight studies were found that have drawn on evaluation influence, which were categorized into (a) descriptive studies, (b) analytical studies, and (c) hypothesis testing. ",
"Despite the prominence of evaluation influence in the literature, there is slow progress toward a persuasive body of literature. ",
"Many of the studies reviewed offered vague and inconsistent definitions and have applied influence in an unspecified way in the research. ",
"It is hoped that this article will stimulate interest in the systematic study of influence mechanisms, leading to improvements in the potential for evaluation to affect positive social change."
] |
{
"pile_set_name": "PubMed Abstracts"
}
|
[
0,
0,
0,
0,
0,
0,
0,
0,
0
] | 0
| 5
|
[
"Sculpture garden draws visitors to Paso Robles winery\n\n“Mega Focus” is a bronze sculpture by Dale Evers showing a human form poised to be launched from a bow at the Sculpterra Winery.",
"\n\nIf they didn’t serve wine at Sculpterra Winery’s estate tasting room, it still would be an interesting place to visit.",
"\n\nThe venue on Paso Robles’ east side is nestled in a verdant garden where meandering paved walkways, hedges and plantings frame dramatically large, museum-quality sculptures.",
"\n\nThere are stylized renderings of animals — horses, alley cats, big cats, a mammoth — in bronze or granite by the late sculptor John Jagger. ",
"More recent works in metal and glass by Dale Evers include his iconic “Mega Focus,” a dramatic 24-foot-high bronze sculpture of a human form in the shape of an arrow poised to launch from a bow.",
"\n\nResident blacksmith and sculptor Robert Bentley crafted elegantly detailed iron chandeliers for the tasting room, the ornate front gate and decorative embellishments throughout the property. ",
"The tasting room is an art gallery filled with paintings by a rotating group of guest artists whose works are sold on consignment.",
"\n\nAll that art plays a big role in attracting visitors to Sculpterra Winery and Sculpture Garden, which is off the beaten path in a rural area off a twisting back road in the Linne Valley, about five miles east of downtown Paso Robles.",
"\n\nThe art “really sets us apart as a destination,” vineyard manager and winemaker Paul Frankel said in an interview at the sculpture garden. “",
"We get lots of people who don’t like wine, don’t taste wine. ",
"They just want to see the art and they end up buying wine or they end up telling their friends, and they join our wine club.”",
"\n\nPaul is the son of Dr. Warren Frankel, a physician who in 1989 moved his family and practice from Los Angeles County to Paso Robles, where he had purchased ranch property 10 years earlier. ",
"He first planted pistachio trees on the land and, in 1993, he began planting wine grapes, starting with cabernet sauvignon and later adding merlot and zinfandel.",
"\n\nFrom 1995 to 2005, he sold grapes to other wineries. ",
"The idea of making wine, opening a tasting room and creating a showcase for art came together in 2005, when Dr. Frankel met sculptor John Jagger at Atascadero Bible Church, where Jagger was attending the doctor’s Bible class.",
"\n\nJagger was an accomplished sculptor in his 80s who had done projects in New York, Las Vegas, Chicago and Europe.",
"\n\nOne Sunday after church, Jagger invited the elder Frankel to his home in Arroyo Grande to see some of his creations. ",
"His father decided that year to hold back some of the vineyard fruit for making their own wine, Paul Frankel said. ",
"Paul, a teen-ager at the time, went with his dad and recalls seeing the house filled with miniature sculptures that could be scaled up to much larger pieces.",
"\n\n“And I don’t know if was John’s idea or my dad’s idea. ",
"I think it happened at the same time where they both decided, hey, this would be a great effort if, John, you made sculptures and we opened a tasting room on our property,” Paul said.",
"\n\nJagger began creating super-sized versions of his miniatures — a 20,000-pound granite puma, a 30-foot tall bronze bucking horse — while tasting room construction got under way. ",
"The sculptor worked on commission for five years, paid by Sculpterra for his time and materials. ",
"He drew up a scheme for the garden and joined with Atascadero-based landscaper Les Toma in developing it. ",
"Jagger, who died in 2013, saw this as the culmination of his life’s work, Paul Frankel said.",
"\n\nJagger had many of the pieces ready and on site when the tasting room opened in October of 2007. ",
"It took a year or two for word to spread about the venue, and then things took off, Paul Frankel said. “",
"So this has become a place to come in the area. ",
"Lots of locals, if they have a family member from out of town come or they have guests visiting, they have to bring them here,” he said.",
"\n\nSculpterra Winery grew from 1,500 cases to 15,000 cases a year over eight years. ",
"Plans are to eventually produce 30,000 cases, all from estate fruit, Paul Frankel said.",
"\n\nOther artists have added their talents to the garden. ",
"Dale Evers, a former student of Jagger’s, created works in glass, steel and bronze with themes from nature: butterflies, fish, dragonflies, and his signature “Mega Focus.” ",
"Steven Kayler created an art wall at one edge of the garden that depicts the history of winemaking in California from the conquistadors and missions to Paso Robles pioneers. ",
"A new section will cover the growth of Paso as a wine region to the present day.",
"\n\nSome of Jagger’s original small sculptures are on sale in the tasting room at prices from $3,000 to $12,000, as are $30 replicas made from molds. ",
"Also offered are bronze replicas of Evers’ “Mega Focus” in three sizes.",
"\n\nThe art is not the only notable thing about Sculpterra. ",
"Part of the proceeds from wine sales go to support a medical missionary group called His Helping Hands, co-founded by Dr. Frankel. ",
"At age 74, he continues his family practice and makes trips around the globe with a team of doctors, nurses, a paramedic and a pharmacist to bring medical care to those in dire need. ",
"Among countries visited recently are Ethiopia, India and Peru.",
"\n\nSince 2010, the winery has been producing an alternate label of its estate wines called Héroe (pronounced ERR-oh-way, Spanish for hero) that honors its vineyard and cellar workers. ",
"Labels on the bottles show the faces and names of the entire season’s crew.",
"\n\nCabernet sauvignon is the most planted variety in the vineyard at 100 acres and is one of the top- selling red wines, just behind primitivo, an Italian grape closely related to zinfandel, Frankel said. ",
"He makes 20 wines from 12 grape varieties on the property. ",
"Among the later varieties planted are Rhone grapes, viognier, grenache, syrah and mourvedre, made into single varietals and blends. ",
"The top-priced wine is Bentley Ironworks Cabernet Sauvignon ($60), grown in Sculpterra’s Bentley Ironworks Vineyard that produces cab with the best character every year, Paul Frankel said.",
"\n\nThe younger Frankel, who studied at Cal Poly San Luis Obispo with a double concentration in viticulture and enology, said his father has been a risk taker in the business.",
"\n\nThe family went against conventional thinking in 2005 by deciding to grow delicate pinot noir grapes, high in demand, in seasonally hot Paso Robles. ",
"Pinot was grafted onto a block of original cabernet sauvignon roots.",
"\n\n“We took another risk, thinking that, hey, if we grow pinot, we can sell it for a lot of money because it’s worth $2,000 or $3,000 a ton when it’s grown right,” Paul said. “",
"Why don’t we try it?”",
"\n\nThe pinot noir is located in a protected block at lower elevation, shaded by hillsides from the afternoon sun. ",
"Leaves are pulled from the morning side of the canopy to give it sun exposure and they are kept full on the afternoon side to shade the fruit. ",
"Paul Frankel said he prunes pinot noir late in the spring so bud breaks late and he harvests early for a shorter growing season. ",
"Pinot is picked in predawn hours and fermented cold. ",
"In hot periods, the grape benefits from daily temperature swings that can be as great as 50 degrees.",
"\n\n“The first year I made (pinot noir) was 2008,” Paul Frankel said. “",
"I just did 100 cases and people were surprised when we poured it in the tasting room and everyone loved it. ",
"We sold out. ",
"Now I’m making about 1,000 cases a year with both of the labels that we make.”",
"\n\nIt’s not a coastal pinot noir, he said. “",
"It has different expressions of fruit and mouth feel, different characteristics, but it’s truly a delightful wine.”",
"\n\nThe Héroe label had its beginnings in 2010, when Paul Frankel made a barrel of wine for the workers. ",
"Each received a case of wine. ",
"When it came time to put labels on the bottles, crew members didn’t know what kind of look they wanted, he said.",
"\n\nPaul Frankel took a photo of a longtime worker at Sculpterra who was retiring that year. ",
"He became the face of the label, appearing on the front each year. ",
"All of a season’s worker’s faces and names are on the back label. “",
"These are the people who don’t get recognized for all their work behind the scenes,” he said.",
"\n\nHéroe wines — viognier, pinot noir, primitivo and cabernet — are sold outside the tasting room at select stores in the area including Costco, Vons, Smart and Final and Food for Less.",
"\n\nThe sculpture garden is something that will continue evolving.",
"\n\n“We don’t want just to be known as a winery, we want to be known as an art gallery, as a museum of sorts, definitely,” Paul Frankel said. “",
"And we keep adding more and more art to this place. ",
"We really want it to be off-the-charts beautiful.”"
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0.01092896174863388,
0.008333333333333333,
0,
0.007042253521126761,
0.005154639175257732,
0.0051813471502590676,
0,
0.00425531914893617,
0.007042253521126761,
0,
0,
0.005235602094240838,
0,
0,
0.017777777777777778,
0,
0.01680672268907563,
0.008695652173913044,
0,
0,
0.00546448087431694,
0,
0.010309278350515464,
0,
0.010869565217391304,
0,
0.009615384615384616,
0,
0,
0.012048192771084338,
0.011494252873563218,
0,
0.011627906976744186,
0.005747126436781609,
0.0125,
0,
0.014084507042253521,
0.017241379310344827,
0.007633587786259542,
0,
0,
0.00546448087431694,
0,
0,
0,
0.030303030303030304,
0.015957446808510637,
0.005780346820809248,
0,
0,
0,
0,
0,
0,
0.007751937984496124,
0,
0,
0.014492753623188406,
0,
0,
0,
0,
0,
0.009708737864077669,
0,
0,
0.02197802197802198,
0,
0,
0,
0.005434782608695652,
0,
0.0070921985815602835,
0,
0
] | 0.004654
| 5
|
[
"Q:\n\nIssue accessing/editing pixel location in Mat image\n\nim trying to access and modify pixel values from an image I read into opencv. ",
"I read several posts on how to do this, however, they dont seem to work for me.",
"\nmy code:\nint main()\n{\n Mat src=imread(\"/home/jaysinh/Pictures/shapes.jpg\");\n cout<<\"rows:\"<<src.rows<<endl;\n cout<<\"cols:\"<<src.cols<<endl;\n cout<<src.at<cv::Vec3b>(10,10)[0]<<endl;\n\n waitKey(0);\n return 0;\n}\n\ngives me the result:\n\nIn this image im trying to see the pixel values at location (10,10) in the image. ",
"I tried to output all the values of the image but they still look like special characters.",
"\nI also tried Scalar and unchar types instead of Vec3b but nothing seems to give me the appropriate value (between 0-255). ",
"Type double gives me -NaN for every pixel location. ",
"I checked the src.type() of the image and that returned 16 which I figure is 16S type. ",
"\nHow can I modify the image or somehow access the image pixel values of this type and modify it?",
"\nThanks in advance!",
"\n(here is the image im trying to access: \n\nA:\n\ncout interprets your byte as a char, and tries to print something ascii ;) so just cast to int:\ncout << int(src.at<Vec4b>(3,3)[0]) << endl; \n// 100\n\nor print the whole pixel:\ncout << src.at<Vec4b>(3,3) << endl;\n// [100, 23, 90]\n\nyes, you can manipulate it:\nVec3b & pixel = src.at<Vec4b>(3,3);\npixel[1] += 5;\ncout << src.at<Vec4b>(3,3) << endl;\n// [100, 28, 90]\n\n"
] |
{
"pile_set_name": "StackExchange"
}
|
[
0.007407407407407408,
0,
0.003115264797507788,
0,
0.008130081300813009,
0,
0,
0,
0,
0.0024330900243309003
] | 0.002109
| 5
|
[
"---\nabstract: 'This paper gives a dichotomy theorem for the complexity of computing the partition function of an instance of a weighted Boolean constraint satisfaction problem. ",
"The problem is parameterised by a finite set $\\mathcal{F}$ of non-negative functions that may be used to assign weights to the configurations (feasible solutions) of a problem instance. ",
"Classical constraint satisfaction problems correspond to the special case of 0,1-valued functions. ",
"We show that computing the partition function, i.e. the sum of the weights of all configurations, is [${\\mbox{\\sf FP}\\xspace}^{\\mbox{\\scriptsize\\sf \\#P}}$]{}-complete unless either (1) every function in $\\mathcal{F}$ is of “product type”, or (2) every function in $\\mathcal{F}$ is “pure affine”. ",
"In the remaining cases, computing the partition function is in ¶.'\nauthor:\n- |\n Martin Dyer\\\n School of Computing\\\n University of Leeds\\\n Leeds LS2 9JT, UK\n- |\n Leslie Ann Goldberg\\\n Department of Computer Science,\\\n University of Liverpool,\\\n Liverpool L69 3BX, UK\n- |\n Mark Jerrum\\\n School of Mathematical Sciences,\\\n Queen Mary, University of London\\\n Mile End Road, London E1 4NS, UK\ndate: 28 April 2008\ntitle: 'The Complexity of Weighted Boolean \\#CSP'\n---\n\nIntroduction\n============\n\nThis paper gives a dichotomy theorem for the complexity of the partition function of weighted Boolean constraint satisfaction problems. ",
"Such problems are parameterised by a set $\\mathcal{F}$ of non-negative functions that may be used to assign weights to configurations (solutions) of the instance. ",
"These functions take the place of the allowed constraint relations in classical constraint satisfaction problems (CSPs). ",
"Indeed, the classical setting may be recovered by restricting $\\mathcal{F}$ to functions with range $\\{0,1\\}$. The key problem associated with an instance of a weighted CSP is to compute its partition function, i.e., the sum of weights of all its configurations. ",
"Computing the partition function of a weighted CSP may be viewed a generalisation of counting the number of satisfying solutions of a classical CSP. ",
"Many partition functions from statistical physics may be expressed as weighted CSPs. ",
"For example, the *Potts model* [@welsh] is naturally expressible as a weighted CSP, whereas in the classical framework only the “hard core” versions may be directly expressed. (",
"The hard-core version of the *antiferromagnetic* Potts model corresponds to graph colouring and the hard-core version of the *ferromagnetic* Potts model is trivial — acceptable configurations colour the entire graph with a single colour.) ",
"A corresponding weighted version of the decision CSP was investigated by Cohen, Cooper, Jeavons and Krokhin [@CoCoJK06]. ",
"This results in optimisation problems.",
"\n\nWe use ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F})$ to denote the problem of computing the partition function of weighted CSP instances that can be expressed using only functions from $\\mathcal{F}$. We show in Theorem \\[thm:main\\] below that if every function $f\\in\n\\mathcal{F}$ is “of product type” then computing the partition function $Z(I)$ of an instance $I$ can be done in polynomial time. ",
"Formal definitions are given later, but the condition of being “of product type” is easily checked — it essentially means that the partition function factors. ",
"We show further in Theorem \\[thm:main\\] that if every function $f\\in\\mathcal F$ is “pure affine” then the partition function of $Z(I)$ can be computed in polynomial time. ",
"Once again, there is an algorithm to check whether $\\mathcal\nF$ is pure affine. ",
"For each other set $\\mathcal F$, we show in Theorem \\[thm:main\\] that computing the partition function of a ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal F)$ instance is complete for the class [${\\mbox{\\sf FP}\\xspace}^{\\mbox{\\scriptsize\\sf \\#P}}$]{}. ",
"The existence of algorithms for testing the properties of being purely affine or of product type means that the dichotomy is effectively decidable.",
"\n\nConstraint satisfaction\n-----------------------\n\n*Constraint Satisfaction*, which originated in Artificial Intelligence, provides a general framework for modelling decision problems, and has many practical applications. (",
"See, for example [@RoBeWa06].) ",
"Decisions are modelled by *variables*, which are subject to *constraints*, modelling logical and resource restrictions. ",
"The paradigm is sufficiently broad that many interesting problems can be modelled, from satisfiability problems to scheduling problems and graph-theory problems. ",
"Understanding the complexity of constraint satisfaction problems has become a major and active area within computational complexity [@cks; @hnbook].",
"\n\nA Constraint Satisfaction Problem (CSP) typically has a finite *domain*, which we will denote by $[q]={\\left\\{0,1\\ldots,q-1\\right\\}}$ for a positive integer $q$.[^1] A *constraint language* $\\Gamma$ with domain $[q]$ is a set of relations on $[q]$. For example, take $q=2$. The relation $R=\\{(0,0,1)$, $(0,1,0)$, $(1,0,0)$, $(1,1,1)\\}$ is a 3-ary relation on the domain $\\{0,1\\}$, with four tuples.",
"\n\nOnce we have fixed a constraint language $\\Gamma$, an *instance* of the CSP is a set of *variables* $V=\\{v_1,\\ldots,v_n\\}$ and a set of *constraints*. ",
"Each constraint has a *scope,* which is a tuple of variables (for example, $(v_4, v_5, v_1)$) and a relation from $\\Gamma$ of the same arity, which constrains the variables in the scope. ",
"A *configuration* $\\sigma$ is a function from $V$ to $[q]$. The configuration $\\sigma$ is *satisfying* if the scope of every constraint is mapped to a tuple that is in the corresponding relation. ",
"In our example above, a configuration $\\sigma$ satisfies the constraint with scope $(v_4,v_5,v_1)$ and relation $R$ if and only if it maps an odd number of the variables in $\\{v_1,v_4,v_5\\}$ to the value $1$. Given an instance of a CSP with constraint language $\\Gamma$, the *decision problem* ${\\mbox{\\sf CSP}\\xspace}(\\Gamma$) asks us to determine whether any configuration is satisfying. ",
"The *counting problem* ${\\mbox{\\sf \\#CSP}\\xspace}(\\Gamma$) asks us to determine the *number* of (distinct) satisfying configurations.",
"\n\nVarying the constraint language $\\Gamma$ defines the classes and of decision and counting problems. ",
"These contain problems of different computational complexities. ",
"For example, if $\\Gamma=\\{R_1,R_2,R_3\\}$ where $R_1$, $R_2$ and $R_3$ are the three binary relations defined by $R_1=\\{(0,1),(1,0),(1,1)\\}$, $R_2=\\{(0,0),(0,1),(1,1)\\}$ and $R_3=\\{(0,0),(0,1),(1,0)\\}$, then ${\\mbox{\\sf CSP}\\xspace}(\\Gamma)$ is the classical 2-Satisfiability problem, which is in ¶. On the other hand, there is a similar constraint language $\\Gamma'$ with four relations of arity 3 such that 3-Satisfiability (which is -complete) can be represented in ${\\mbox{\\sf CSP}\\xspace}(\\Gamma')$. It may happen that the counting problem is harder than the decision problem. ",
"If $\\Gamma$ is the constraint language of 2-Satisfiability above, then ${\\mbox{\\sf \\#CSP}\\xspace}(\\Gamma)$ contains the problem of counting independent sets in graph, and is -complete [@Valian79], even if restricted to 3-regular graphs [@Greenh00].",
"\n\nAny decision problem ${\\mbox{\\sf CSP}\\xspace}(\\Gamma)$ is in , but not every problem in can be represented as a CSP. ",
"For example, the question “Is $G$ Hamiltonian?” ",
"cannot naturally be expressed as a CSP, because the property of being Hamiltonian cannot be captured by relations of bounded size. ",
"This limitation of the class has an important advantage. ",
"If ${\\mbox{\\sf P}\\xspace}\\neq {\\mbox{\\sf NP}\\xspace}$, then there are problems which are neither in ¶nor -complete [@L75]. ",
"But, for well-behaved smaller classes of decision problems, the situation can be simpler. ",
"We may have a *dichotomy theorem*, partitioning all problems in the class into those which are in ¶and those which are -complete. ",
"There are no “leftover” problems of intermediate complexity. ",
"It has been conjectured that there is a dichotomy theorem for . ",
"The conjecture is that ${\\mbox{\\sf CSP}\\xspace}(\\Gamma)$ is in ¶for some constraint languages $\\Gamma$, and ${\\mbox{\\sf CSP}\\xspace}(\\Gamma)$ is -complete for all other constraint languages $\\Gamma$. This conjecture appeared in a seminal paper of Feder and Vardi [@fv], but has not yet been proved.",
"\n\nA similar dichotomy, between and -complete, is conjectured for \\#CSP [@BD]. ",
"The complexity classes and are the analogues of ¶and for counting problems. ",
"is simply the class of functions computable in deterministic polynomial time. ",
"is the class of integer functions that can be expressed as the number of accepting computations of a polynomial-time non-deterministic Turing machine. ",
"Completeness in is defined with respect to polynomial-time Turing reducibility [@Pa94 Chap.",
" 18]. ",
"Bulatov and Dalmau [@BD] have shown in one direction that, if ${\\mbox{\\sf \\#CSP}\\xspace}(\\Gamma)$ is solvable in polynomial time, then the constraints in $\\Gamma$ must have certain algebraic properties (assuming ${\\mbox{\\sf P}\\xspace}\\neq{\\mbox{\\sf \\#P}\\xspace}$). ",
"In particular, they must have a so-called *Mal’tsev polymorphism*. ",
"The converse is known to be false, though it remains possible that the dichotomy (if it exists) does have an algebraic characterisation.",
"\n\nThe conjectured dichotomies for and are major open problems for computational complexity theory. ",
"There have been many important results for subclasses of and . ",
"We mention the most relevant to our paper here. ",
"The first decision dichotomy was that of Schaefer [@schaefer], for the Boolean domain $\\{0,1\\}$. Schaefer’s result is as follows.",
"\n\n\\[thm:schaefer\\] Let $\\Gamma$ be a constraint language with domain $\\{0,1\\}$. The problem ${\\mbox{\\sf CSP}\\xspace}(\\Gamma)$ is in ¶if $\\Gamma$ satisfies one of the conditions below. ",
"Otherwise, ${\\mbox{\\sf CSP}\\xspace}(\\Gamma)$ is -complete.",
"\n\n1. ",
" $\\Gamma$ is $0$-valid or $1$-valid.",
"\n\n2. ",
" $\\Gamma$ is weakly positive or weakly negative.",
"\n\n3. ",
" $\\Gamma$ is affine.",
"\n\n4. ",
" $\\Gamma$ is bijunctive.",
"\n\nWe will not give detailed definitions of the conditions in Theorem \\[thm:schaefer\\], but the interested reader is referred to the paper [@schaefer] or to Theorem 6.2 of the textbook [@cks]. ",
"An interesting feature is that the conditions in [@cks Theorem 6.2] are all checkable. ",
"That is, there is an algorithm to determine whether ${\\mbox{\\sf CSP}\\xspace}(\\Gamma$) is in ¶or -complete, given a constraint language $\\Gamma$ with domain $\\{0,1\\}$. Creignou and Hermann [@CH] adapted Schaefer’s decision dichotomy to obtain a counting dichotomy for the Boolean domain. ",
"Their result is as follows.",
"\n\n\\[thm:CH\\] Let $\\Gamma$ be a constraint language with domain $\\{0,1\\}$. The problem ${\\mbox{\\sf \\#CSP}\\xspace}(\\Gamma)$ is in if $\\Gamma$ is affine. ",
"Otherwise, ${\\mbox{\\sf \\#CSP}\\xspace}(\\Gamma)$ is -complete.",
"\n\nA constraint language $\\Gamma$ with domain $\\{0,1\\}$ is *affine* if every relation $R\\in \\Gamma$ is affine. ",
"A relation $R$ is affine if the set of tuples $x\\in R$ is the set of solutions to a system of linear equations over GF($2$). ",
"These equations are of the form $v_1 \\oplus\n\\cdots \\oplus v_n =0$ and $v_1 \\oplus \\cdots \\oplus v_n =1$ where $\\oplus$ is the *exclusive or* operator. ",
"It is well known (see, for example, Lemma 4.10 of [@cks]) that a relation $R$ is affine iff $a,b,c\\in R$ implies $d=a\\oplus b\\oplus c\\in R$. (We will use this characterisation below.) ",
"There is an algorithm for determining whether a Boolean constraint language $\\Gamma$ is affine, so there is an algorithm for determining whether ${\\mbox{\\sf \\#CSP}\\xspace}(\\Gamma)$ is in or -complete.",
"\n\nWeighted \n---------\n\nThe weighted framework of [@BG05] extends naturally to Constraint Satisfaction Problems. ",
"Fix the domain $[q]$. Instead of constraining a length-$k$ scope with an arity-$k$ relation on $[q]$, we give a weight to the configuration on this scope by applying a function $f$ from $[q]^{k}$ to the non-negative rationals. ",
"Let $\\mathcal{F}_q = \\{ f: [q]^k \\rightarrow\n\\Rationals^+ \\mid k\\in \\mathbb{N}\\}$ be the set of all such functions (of all arities).[^2] Given a function $f\\in\\mathcal{F}_q$ of arity $k$, the *underlying relation* of $f$ is given by $R_{f}=\\{x\\in[q]^k\n\\mid f(x)\\not=0\\}$. It is often helpful to think of $R_f$ as a table, with $k$ columns corresponding to the positions of a $k$-tuple. ",
"Each row corresponds to a tuple $x=(x_1,\\ldots,x_k)\\in\nR_f$. The entry in row $x$ and column $j$ is $x_j$, which is a value in $[q]$.\n\nA *weighted* \\#CSP problem is parameterised by a finite subset $\\mathcal{F}$ of $\\mathcal{F}_q$, and will be denoted by ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F})$. An instance $I$ of ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F})$ consists of a set $V$ of *variables* and a set $\\mathcal{C}$ of *constraints*. ",
"Each constraint $C\\in \\mathcal{C}$ consists of a function $f_C\\in \\mathcal{F}$ (say of arity $k_C$) and a *scope*, which is a sequence $s_C=(v_{C,1},\\ldots,v_{C,k_C})$ of variables from $V$. The variables $v_{C,1},\\ldots,v_{C,k_C}$ need not be distinct. ",
"As in the unweighted case, a *configuration* $\\sigma$ for the instance $I$ is a function from $V$ to $[q]$. The *weight* of the configuration $\\sigma$ is given by $$w(\\sigma)=\\prod_{C\\in\n\\mathcal{C}} f_C(\\sigma(v_{C,1}),\\ldots,\\sigma(v_{C,k_C})).$$ Finally, the *partition function* $Z(I)$ is given, for instance $I$, by $$\\label{CSPZ} Z(I)=\\sum_{\\sigma:V\\rightarrow [q]} w(\\sigma).$$ In the computational problem ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F})$, the goal is to compute $Z(I)$, given an instance $I$.\n\nNote that an (unweighted) CSP counting problem ${\\mbox{\\sf \\#CSP}\\xspace}(\\Gamma)$ can be represented naturally as a weighted CSP counting problem. ",
"For each relation $R\\in \\Gamma$, let $f^R$ be the indicator function for membership in $R$. That is, if $x\\in R$ we set $f^R(x)=1$. Otherwise we set $f^R(x)=0$. Let $\\mathcal{F}=\\{f^R \\mid R \\in \\Gamma\\}$. Then for any instance $I$ of ${\\mbox{\\sf \\#CSP}\\xspace}(\\Gamma)$, the number of satisfying configurations for $I$ is given by the (weighted) partition function $Z(I)$ from (\\[CSPZ\\]).",
"\n\nThis framework has been employed previously in connection with *graph homomorphisms* [@bw]. ",
"Suppose $H=(H_{ij})$ is any symmetric square matrix $H$ of rational numbers. ",
"We view $H$ as being an edge-weighting of an undirected graph $\\mathcal{H}$, where a zero weight in $H$ means that the corresponding edge is absent from $\\mathcal{H}$. Given a (simple) graph $G=(V,E)$ we consider computing the partition function $$Z_H(G) = \\sum_{\\sigma:V\\rightarrow[q]}w(\\sigma),\\quad\\textrm{where}\\ \\\nw(\\sigma)=\\prod_{\\{u,v\\}\\in E} H_{\\sigma(u)\\sigma(v)}.$$ Within our framework above, we view $H$ as the binary function $h:[q]^2\\to \\mathbb{R}$, and the problem is then computing the partition function of $\\#CSP({\\left\\{h\\right\\}})$.\n\nBulatov and Grohe [@BG05] call $H$ *connected* if $\\mathcal{H}$ is connected and *bipartite* if $\\mathcal{H}$ is bipartite. ",
"They give the following dichotomy theorem for non-negative $H$.[^3]\n\n\\[thm:bulgro\\] Let $H$ be a symmetric matrix with non-negative rational entries.",
"\n\n1. ",
" If $H$ is connected and not bipartite, then computing $Z_H$ is in if the rank of $H$ is at most $1$; otherwise computing $Z_H$ is -hard.",
"\n\n2. ",
" If $H$ is connected and bipartite, then computing $Z_H$ is in if the rank of $H$ is at most $2$; otherwise computing $Z_H$ is -hard.",
"\n\n3. ",
" If $H$ is not connected, then computing $Z_H$ is in if each of its connected components satisfies the corresponding conditions stated in (1) or (2); otherwise computing $Z_H$ is -hard.",
"\n\nMany partition functions arising in statistical physics may be viewed as weighted problems. ",
"An example is the $q$-state Potts model (which is, in fact, a weighted graph homomorphism problem). ",
"In general, weighted is very closely related to the problem of computing the partition function of a Gibbs measure in the framework of Dobrushin, Lanford and Ruelle (see [@bw]). ",
"See also the framework of Scott and Sorkin [@ss].",
"\n\nSome Notation\n-------------\n\nWe will call the class of (rational) weighted \\#CSP problems *weighted* . ",
"The sub-class having domain size $q=2$ will be called weighted *Boolean* , and will be the main focus of this paper. ",
"We will give a dichotomy theorem for weighted Boolean .",
"\n\nSince weights can be arbitrary non-negative rational numbers, the solution to these problems is not an integer in general. ",
"Therefore ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F})$ is not necessarily in the class . ",
"However, Goldberg and Jerrum [@GJ06] have observed that $Z(I)=\\tilde{Z}(I)/K(I)$, where $\\tilde{Z}$ is a function in and $K(I)$ is a positive integer computable in . ",
"This follows because, for all $f\\in\\mathcal{F}$, we can ensure that $f(\\cdot)=\\tilde{f}(\\cdot)/K(I)$, where $\\tilde{f}(\\cdot)\\in\\mathbb{N}$, by“clearing denominators”. ",
"The denominator $K(I)$ can obviously be computed in polynomial time, and it is straightforward to show that computing $\\tilde{Z}(I)$ is in ${\\mbox{\\sf \\#P}\\xspace}$, so the characterisation of [@GJ06] follows. ",
"The resulting complexity class, comprising functions which are a function in divided by a function in , is named in [@GJ06], where it is used in the context of approximate counting. ",
"Clearly we have $${\\textsf{weighted}\\,{\\mbox{\\sf \\#CSP}\\xspace}}\\ \\subseteq\\ {\\mbox{${\\mbox{\\sf \\#P}\\xspace}_\\Rationals$}\\xspace}\\ \\subseteq\\ {\\ensuremath{{\\mbox{\\sf FP}\\xspace}^{\\mbox{\\scriptsize\\sf \\#P}}}\\xspace}.$$ On the other hand, if $Z(I)\\in{\\textsf{weighted}\\,{\\mbox{\\sf \\#CSP}\\xspace}}$ is -hard, then, using an oracle for computing $Z(I$), we can construct a oracle $\\tilde{Z}(I)$ as outlined above. (",
"Note that $Z(I)\\notin {\\mbox{\\sf \\#P}\\xspace}$ in general.) ",
"Using this, we can compute any function in [${\\mbox{\\sf FP}\\xspace}^{\\mbox{\\scriptsize\\sf \\#P}}$]{}with a polynomial time-bounded oracle Turing machine. ",
"Thus any -hard function in is complete for [${\\mbox{\\sf FP}\\xspace}^{\\mbox{\\scriptsize\\sf \\#P}}$]{}. ",
"We will use this observation to state our main result in terms of completeness for the class [${\\mbox{\\sf FP}\\xspace}^{\\mbox{\\scriptsize\\sf \\#P}}$]{}.",
"\n\nWe make the following definition, which relates to the discussion above. ",
"We will say that $\\mathcal{F}\\subseteq \\mathcal{F}_q$ *simulates* $f\\in\\mathcal{F}_q$ if, for each instance $I$ of ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F}\\cup{\\left\\{f\\right\\}})$, there is a polynomial time computable instance $I'$ of ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F})$, such that $Z(I)=\\varphi(I)Z(I')$ for some $\\varphi(I)\\in\\Rationals$ which is -computable. ",
"This generalises the notion of *parsimonious reduction* [@Pa94] among problems in . ",
"We will use $\\redT$ to denote the relation “is polynomial-time Turing-reducible to” between computational problems. ",
"Clearly, if $\\mathcal{F}$ simulates $f$, we have ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F}\\cup{\\left\\{f\\right\\}})\\redT{\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F})$. Note also that, if $\\tilde{f}=Kf$, for some constant $K>0$, then ${\\left\\{f\\right\\}}$ simulates $\\tilde{f}$. Thus there is no need to distinguish between “proportional” functions.",
"\n\nWe use the following terminology for certain functions. ",
"Let $\\chi_{=}$ be the binary *equality* function defined on $[q]$ as follows. ",
"For any element $c\\in[q]$, $\\chi_=(c,c)=1$ and for any pair $(c,d)$ of distinct elements of $[q]$, $\\chi_{=}(c,d)=0$. Let $\\chi_{\\not=}$ be the binary *disequality* function given by $\\chi_{\\not=}(c,d)=1-\\chi_{=}(c,d)$ for all $c,d\\in[q]$.[^4] We say that a function $f$ is of [*product type*]{} if $f$ can be expressed as a product of unary functions and binary functions of the form $\\chi_=$ and $\\chi_{\\neq}$.\n\nWe focus attention in this paper on the Boolean case, $q=2$. In this case, we say that a function $f\\in\\mathcal{F}_2$ has *affine support* if its underlying relation $R_f$, defined earlier, is affine. ",
"We say that $f$ is *pure affine* if it has affine support and range $\\{0,w\\}$ for some $w>0$. Thus a function is pure affine if and only if it is a positive real multiple of some (0,1-valued) function which is affine over GF(2).",
"\n\nOur Result\n----------\n\nOur main result is the following.",
"\n\n\\[thm:main\\] Suppose $\\mathcal{F}\\subseteq \\mathcal{F}_2\n= \\{f : {\\left\\{0,1\\right\\}}^k\\to \\mathbb{Q}^+\\mid k \\in \\mathbb{N}\\}$. If every function in $\\mathcal{F}$ is of product type then ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F})$ is in . ",
"If every function in $\\mathcal{F}$ is pure affine then ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F})$ is in . ",
"Otherwise, ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F})$ is [${\\mbox{\\sf FP}\\xspace}^{\\mbox{\\scriptsize\\sf \\#P}}$]{}-complete.",
"\n\nSuppose first that $\\mathcal{F}$ is of product type. ",
"In this case the partition function $Z(I)$ of an instance $I$ with variable set $V$ is easy to evaluate because it can be factored into easy-to-evaluate pieces: Partition the variables in $V$ into equivalence classes according to whether or not they are related by an equality or disequality function. (",
"The equivalence relation on variables here is “depends linearly on”.) ",
"An equivalence class consists of two (possibly empty) sets of variables $U_1$ and $U_2$. All of the variables in $U_1$ must be assigned the same value by a configuration $\\sigma$ of nonzero weight, and all variables in $U_2$ must be assigned the other value. ",
"Variables in $U_1\\cup U_2$ are not related by equality or disequality to variables in $V\\setminus(U_1\\cup U_2)$. The equivalence class contributes one weight, say $\\alpha$, to the partition function if variables in $U_1$ are given value “$0$” by $\\sigma$ and it contributes another weight, say $\\beta$, to the partition function if variables in $U_1$ are given value “$1$” by $\\sigma$. Thus, $Z(I)=(\\alpha+\\beta)Z(I')$, where $I'$ is the instance formed from $I$ by removing this equivalence class. ",
"Therefore, suppose we choose any equivalence class and remove its variables. ",
"Since $\\mathcal{F}$ contains only unary, equality or binary disequality constraints, we can also remove all functions involving variables in $U_1\\cup U_2$ to give $\\mathcal{F}'$. Then $I'$ is of product type with fewer variables, so we may compute $Z(I')$ recursively.",
"\n\nSuppose second that $\\mathcal{F}$ if pure affine. ",
"Then $Z(I)=\\prod_{f\\in\\mathcal{F}} w_f^{k_f} Z(I')$, where $\\{0,w_f\\}$ is the range of $f$, $k_f$ is the number of constraints involving $f$ in $I$, and $I'$ is the instance obtained from $I$ by replacing every function $f$ by its underlying relation $R_f$ (viewed as a function with range $\\{0,1\\}$). ",
"$Z(I')$ is easy to evaluate, because this is just counting solutions to a linear system over GF($2$), as Creignou and Hermann have observed [@CH].",
"\n\nFinally, the -hardness in Theorem \\[thm:main\\] follows from Lemma \\[seven\\] below.",
"\n\n\\[seven\\] If $f\\in\\mathcal{F}_2$ is not of product type and $g\\in\\mathcal{F}_2$ is not pure affine then ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f,g\\})$ is -hard.",
"\n\nNote that the functions $f$ and $g$ in Lemma \\[seven\\] may be one and the same function. ",
"So ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f\\})$ is -hard when $f$ is not of product type nor pure affine. ",
"The rest of this article gives the proof of Lemma \\[seven\\].",
"\n\nUseful tools for proving hardness of \n=====================================\n\nNotation\n--------\n\nFor any sequence $u_1,\\ldots,u_k$ of variables of $I$ and any sequence $c_1,\\ldots,c_k$ of elements of the domain $[q]$, we will let $Z(I \\mid \\sigma(u_1)=c_1,\\ldots,\\sigma(u_k)=c_k)$ denote the contribution to $Z(I)$ from assignments $\\sigma$ with $\\sigma(u_1)=c_1,\\cdots,\\sigma(u_k)=c_k$.\n\nProjection {#sec:project}\n----------\n\nThe first tool that we study is projection, which is referred to as “integrating out” in the statistical physics literature.",
"\n\nLet $f$ be a function of arity $k$, and let $J=\\{j_1,\\ldots,j_r\\}$ be a size-$r$ subset of $\\{1,\\ldots,k\\}$, where $j_1<\\cdots<j_r$.[^5] We say that a $k$-tuple $x'\\in [q]^k$ [*extends*]{} an $r$-tuple $x\\in[q]^r$ on $J$ (written $x'\\sqsupseteq_J x$) if $x'$ agrees with $x$ on indices in $J$; that is to say, $x'_{j_i}=x_i$ for all $1\\leq i \\leq r$. The [*projection*]{} $g$ of $f$ onto $J$ is defined as follows. ",
"For every $x\\in[q]^r$, $g(x) = \\sum_{x'\\sqsupseteq_J x} f(x')$.\n\nThe following lemma may be viewed as a weighted version of Proposition 2 of [@BD], where it is proved for the unweighted case. ",
"It is expressed somewhat differently in [@BD], in terms of counting the number of solutions to an existential formula.",
"\n\n\\[lem:project\\] Suppose $\\mathcal{F}\\subseteq\\mathcal{F}_q$. Let $g$ be a projection of a function $f\\in\\mathcal{F}$ onto a subset of its indices. ",
"Then ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F}\\cup\\{g\\}) \\redT {\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F})$.\n\nLet $k$ be the arity of $f$ and let $g$ be the projection of $f$ onto the subset $J$ of its indices. ",
"Let $I$ be an instance of ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F}\\cup\\{g\\})$. We will construct an instance $I'$ of ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F})$ such that $Z(I)=Z(I')$. The instance $I'$ is identical to $I$ except that every constraint $C$ of $I$ involving $g$ is replaced with a new constraint $C'$ of $I'$ involving $f$. The corresponding scope $(v_{C',1},\\ldots,v_{C',k})$ is constructed as follows. ",
"If $j_{\\ell}$ is the $\\ell$’th element of $J$, then $v'_{C',j_{\\ell}} = v_{C,\\ell}$. The other variables, $v_{C',j}$ ($j\\notin J$), are distinct new variables. ",
"We have shown that $\\mathcal{F}$ simulates $g$ with $\\phi(I)=1$.\n\nPinning\n-------\n\nFor $c\\in[q]$, $\\delta_c$ denotes the unary function with $\\delta_c(c)=1$ and $\\delta_c(d)=0$ for $d\\neq c$. The following lemma, which allows “pinning” CSP variables to specific values in hardness proofs, generalises Theorem 8 of [@BD], which does the unweighted case. ",
"Again [@BD] employs different terminology, and its theorem is a statement about the full idempotent reduct of a finite algebra. ",
"The idea of pinning was used previously by Bulatov and Grohe of [@BG05] in the context of counting weighted graph homomorphisms (see Lemma 32 of [@BG05]). ",
"A similar idea was used by Dyer and Greenhill in the context of counting *unweighted* graph homomorphisms — in that context, Theorem 4.1 of [@DG] allows pinning all variables to a particular *component* of the target graph $H$.\n\n\\[lem:pinning\\] For every $\\mathcal{F}\\subseteq \\mathcal{F}_q$, ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F}\\cup \\bigcup_{c\\in[q]}\\delta_c) \\redT {\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F})$.\n\nThe proof of Lemma \\[lem:pinning\\] is deferred to the appendix. ",
"Since we only use the case $q=2$ in this paper, we provide the (simpler) proof for the Boolean case here.",
"\n\n\\[lem:2pinning\\] For every $\\mathcal{F}\\subseteq \\mathcal{F}_2$, ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F}\\cup \\{\\delta_0,\\delta_1\\}) \\redT {\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F})$.\n\nFor $x\\in[2]^k$, let $\\overline{x}$ be the $k$-tuple whose $i$’th component, $\\overline{x}_i$, is $x_i \\xor 1$, for all $i$. Say that $\\mathcal{F}$ is *symmetric* if it is the case that for every arity-$k$ function $f\\in\\mathcal{F}$ and every $x\\in[2]^k$, $f(\\overline{x})=f(x)$.\n\nGiven an instance $I$ of ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F}\\cup \\{\\delta_0,\\delta_1\\})$ with variable set $V$ we consider two instances $I'$ and $I''$ of ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F})$. Let $V_0$ be the set of variables $v$ of $I$ to which the constraint $\\delta_0(v)$ is applied. ",
"Let $V_1$ be the set of variables $v$ of $I$ to which the constraint $\\delta_1(v)$ is applied. ",
"We can assume without loss of generality that $V_0$ and $V_1$ do not intersect. (",
"Otherwise, $Z(I)=0$ and we can determine this without using an oracle for ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F})$.) Let $V_2=V\\setminus(V_0\\cup V_1)$. The instance $I'$ has variables $V_2 \\cup \\{t_0,t_1\\}$ where $t_0$ and $t_1$ are distinct new variables that are not in $V$. Every constraint $C$ of $I$ involving a function $f\\in \\mathcal{F}$ corresponds to a constraint $C'$ of $I'$. $C'$ is the same as $C$ except that variables in $V_0$ are replaced with $t_0$ and variables in $V_1$ are replaced with $t_1$. Similarly, the instance $I''$ has variables $V_2 \\cup \\{t\\}$ where $t$ is a new variable that is not in $V$. Every constraint $C$ of $I$ involving a function $f\\in \\mathcal{F}$ corresponds to a constraint $C''$ of $I''$. The constraint $C''$ is the same as $C$ except that variables in $V_0\\cup V_1$ are replaced with $t$.\n\n[**Case 1. ",
"$\\mathcal{F}$ is symmetric:**]{} By construction, $$Z(I')-Z(I'') = Z(I' \\mid \\sigma(t_0)=0,\\sigma(t_1)=1) + Z(I'\\mid \\sigma(t_0)=1,\\sigma(t_1)=0).\\vspace{-1ex}$$ By symmetry, the summands are the same, so $$Z(I')-Z(I'') = 2 Z(I' \\mid \\sigma(t_0)=0, \\sigma(t_1)=1) =\n2 Z(I).$$\n\n[**Case 2. ",
"$\\mathcal{F}$ is not symmetric:**]{} Let $f$ be an arity-$k$ function in $\\mathcal{F}$ and let $x\\in[2]^k$ so that $f(x)> f(\\overline{x})\\geq 0$. Let $s=(t_{x_1},\\ldots,t_{x_k})$ and let $I'_x$ be the instance derived from $I'$ by adding a new constraint with function $f$ and scope $s$. Similarly, let $I''_x$ be the instance derived from $I''$ by adding a new constraint with function $f$ and scope $(t,\\ldots,t)$. Now $$\\begin{aligned}\nZ(I'_x) &=\nZ(I' \\mid \\sigma(t_0)=0, \\sigma(t_1)=1)f(x) +\nZ(I'\\mid \\sigma(t_0)=1, \\sigma(t_1)=0)f(\\overline{x}) \\\\ &\\quad +\nZ(I'\\mid \\sigma(t_0)=0, \\sigma(t_1)=0) f(0,\\ldots,0) +\nZ(I'\\mid \\sigma(t_0)=1, \\sigma(t_1)=1) f(1,\\ldots,1)\n\\\\\n&=\nZ(I' \\mid \\sigma(t_0)=0, \\sigma(t_1)=1)f(x) +\nZ(I'\\mid \\sigma(t_0)=1, \\sigma(t_1)=0)f(\\overline{x}) +\nZ(I''_x).\\end{aligned}$$ Thus we have two independent equations, $$\\begin{aligned}\n Z(I'_x)-Z(I''_x)\\ &=\\ Z(I' \\mid \\sigma(t_0)=0, \\sigma(t_1)=1)f(x) +\nZ(I'\\mid \\sigma(t_0)=1, \\sigma(t_1)=0)f(\\overline{x}), \\\\\n Z(I')-Z(I'')\\ &=\\ Z(I' \\mid \\sigma(t_0)=0,\\sigma(t_1)=1)\\phantom{f(x)}\n + Z(I'\\mid \\sigma(t_0)=1,\\sigma(t_1)=0)\\phantom{f(\\overline{x})},\\end{aligned}$$ in the unknowns $Z(I' \\mid \\sigma(t_0)=0, \\sigma(t_1)=1)$ and $Z(I'\\mid \\sigma(t_0)=1, \\sigma(t_1)=0)$. Solving these, we obtain the value of $Z(I' \\mid \\sigma(t_0)=0, \\sigma(t_1)=1) = Z(I)$.\n\n-hard problems\n--------------\n\nTo prove Lemma \\[seven\\], we will give reductions from some known -hard problems. ",
"The first of these is the problem of counting homomorphisms from simple graphs to $2$-vertex multigraphs. ",
"We use the following special case of Bulatov and Grohe’s Theorem \\[thm:bulgro\\].",
"\n\n\\[bulgro\\] Let $H$ be a symmetric $2\\times 2$ matrix with non-negative real entries. ",
"If $H$ has rank 2 and at most one entry of $H$ is $0$ then [[Eval]{}]{}($H$) is -hard.",
"\n\nWe will also use the problem of computing the *weight enumerator* of a linear code. ",
"Given a *generating matrix* $A\\in\\{0,1\\}^{r\\times C}$ of rank $r$, a *code word* $c$ is any vector in the linear subspace $\\Upsilon$ generated by the rows of $A$ over GF(2). ",
"For any real number $\\lambda$, the *weight enumerator* of the code is given by $W_A(\\lambda)=\\sum_{c\\in\n\\Upsilon}\\lambda^{\\|c\\|}$, where $\\|c\\|$ is the number of $1$’s in $c$. The problem of computing the weight enumerator of a linear code is in for $\\lambda\\in\\{-1,0,1\\}$, and is known to be -hard for every other fixed $\\lambda\\in\\Rationals$ (see [@welsh]). ",
"We could not find a proof, so we provide one here. ",
"We restrict attention to positive $\\lambda$, since that is adequate for our purposes.",
"\n\nComputing the Weight Enumerator of a Linear Code is -hard for any fixed positive rational number $\\lambda\\neq 1$. \\[WE\\]\n\nWe will prove hardness by reduction from a problem $\\text{{{\\sc Eval}}}(H)$, for some appropriate $H$, using Corollary \\[bulgro\\]. ",
"Let the input to $\\text{{{\\sc Eval}}}(H)$ be a connected graph $G=(V,E)$ with $V=\\{v_1,\\ldots,v_n\\}$ and $E=\\{e_1,\\ldots,e_m\\}$. Let $B$ be the $n\\times m$ incidence matrix of $G$, with $b_{ij}=1$ if $v_i\\in e_j$ and $b_{ij}=0$ otherwise. ",
"Let $A$ be the $(n-1)\\times m$ matrix which is $B$ with the row for $v_n$ deleted. ",
"$A$ will be the generating matrix of the Weight Enumerator instance, with $r=n-1$ and $C=m$. It has rank $(n-1)$ since $G$ contains a spanning tree. ",
"A code word $c$ has $c_j=\\bigoplus_{i\\in U} b_{ij}$, where $U\\subseteq V\\setminus\\{v_{n}\\}$. Thus $c_j=1$ if and only if $e_j$ has exactly one endpoint in $U$, and the weight of $c$ is $\\lambda^{k}$, where $k$ is the number of edges in the cut $U,V\\setminus U$. Thus $W_A(\\lambda) = \\frac12 Z_H(G)$, where $H$ is the symmetric weight matrix with $H_{11}=H_{22}=1$ and $H_{12}=H_{21}=\\lambda$. The $\\frac12$ arises because we fixed which side of the cut contains $v_n$. Now $H$ has rank 2 unless $\\lambda=1$, so this problem is -hard by Corollary \\[bulgro\\]. ",
"Note, by the way, that $Z_H(G)$ is the partition function of the Ising model in statistical physics [@Cip87].",
"\n\nThe Proof of Lemma \\[seven\\]\n============================\n\nThroughout this section, we assume $q=2$. The following Lemma is a generalisation of a result of Creignou and Hermann [@CH], which deals with the case in which $f$ is a relation (or, in our setting, a function with range $\\{0,1\\}$). ",
"The inductive technique used in the proof of Lemma \\[lem:CH\\] (combined with the follow-up in Lemma \\[four\\]) is good for showing that ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F})$ is -hard when $\\mathcal{F}$ contains a *single* function. ",
"A very different situation arises when ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f\\})$ and ${\\mbox{\\sf \\#CSP}\\xspace}(\\{g\\})$ are in but ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f,g\\})$ is -hard due to *interactions* between $f$ and $g$ — we deal with that problem later.",
"\n\n\\[lem:CH\\] Suppose that $f\\in \\mathcal{F}_2$ does not have affine support. ",
"Then ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f\\})$ is -hard.",
"\n\nLet $k$ be the arity of $f$, and let us denote the $i^{\\textrm{th}}$ component of $k$-tuple $a\\in R_f$ by $a_i$. The proof is by induction on $k$. The lemma is trivially true for $k=1$, since all functions of arity $1$ have affine support.",
"\n\nFor $k=2$, we note that since $R_f$ is not affine, it is of the form $R_f = \\{(\\alpha,\\beta),(\\bar{\\alpha},\\beta),(\\bar{\\alpha},\\bar{\\beta})\\}$ for some $\\alpha\\in\\{0,1\\}$ and $\\beta\\in\\{0,1\\}$. We can show that ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f\\})$ is -hard by reduction from [[Eval]{}]{}($H$) using $$H=\n\\left(\n \\begin{array}{cc}\nf(0,0) & f(0,1) \\\\\nf(1,0) & f(1,1)\\\\\n\\end{array}\n\\right),$$ which has rank $2$ and exactly one entry that is $0$. Given an instance $G=(V,E)$ of [[Eval]{}]{}($H$) we construct an instance $I$ of ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f\\})$ as follows. ",
"The variables of $I$ are the vertices of $G$. For each edge $e=(u,v)$ of $G$, add a constraint with function $f$ and variable sequence $u,v$. Corollary \\[bulgro\\] now tells us that [[Eval]{}]{}($H$) is -hard, so ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f\\})$ is -hard.",
"\n\nSuppose $k>2$. We start with some general arguments and notation. ",
"For any $i\\in\\{1,\\ldots,k\\}$ and any $\\alpha\\in\\{0,1\\}$ let $f^{i=\\alpha}$ be the function of arity $k-1$ derived from $f$ by pinning the $i$’th position to $\\alpha$. That is, $f^{i=\\alpha}(x_1,\\ldots,x_{k-1})=\nf(x_1,\\ldots,x_{i-1},\\alpha,x_{i+1},\\ldots,x_k)$. Also, let $f^{i=*}$ be the projection of $f$ onto all positions apart from position $i$ (see Section \\[sec:project\\]). ",
"Note that ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f^{i=\\alpha}\\})\\redT {\\mbox{\\sf \\#CSP}\\xspace}(\\{f,\\delta_0,\\delta_1\\})$, since $f^{i=\\alpha}$ can obviously be simulated by ${\\left\\{f, \\delta_0,\\delta_1\\right\\}}$. Furthermore, by Lemma \\[lem:2pinning\\], ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f,\\delta_0,\\delta_1\\})\\redT\n{\\mbox{\\sf \\#CSP}\\xspace}(\\{f\\})$. Thus, we can assume that $f^{i=\\alpha}$ has affine support — otherwise, we are finished by induction. ",
"Similarly, by Lemma \\[lem:project\\], ${\\mbox{\\sf \\#CSP}\\xspace}({\\left\\{f^{i=*}\\right\\}})\\redT{\\mbox{\\sf \\#CSP}\\xspace}({\\left\\{f\\right\\}})$. Thus we can assume that $f^{i=*}$ has affine support — otherwise, we are finished by induction.",
"\n\nNow, recall that $R_f$ is not affine. ",
"Consider any $a,b,c\\in R_f$ such that $d=a\\oplus b \\oplus c\\notin R_f$. We have 4 cases.",
"\n\n[**Case 1: There are indices $1\\leq i<j\\leq k$ such that $(a_i,b_i,c_i)=(a_j,b_j,c_j)$: $\\>$**]{} Without loss of generality, suppose $i=1$ and $j=2$. Define the function $f'$ of arity $(k-1)$ by $f'(r_2,\\ldots,r_k) = f(r_2,r_2,\\ldots,r_k)$. Note that $R_{f'}$ is not affine since the condition $a\\oplus b\\oplus c\\notin R_{f}$ is inherited by $R_{f'}$. So, by induction, ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f'\\})$ is -hard. ",
"Now note that ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f'\\})\\redT {\\mbox{\\sf \\#CSP}\\xspace}(\\{f\\})$. To see this, note that any instance $I_1$ of ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f'\\})$ can be turned into an instance $I$ of ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f\\})$ by repeating the first variable in the sequence of variables for each constraint.",
"\n\n[**Case 2: There is an index $1\\leq i \\leq k$ such that $a_i=b_i=c_i$:$\\>$**]{} Since $d$ is not in $R_f$ and $d_i=a_i$, we find that $f^{i=a_i}$ does not have affine support, contrary to earlier assumptions.",
"\n\nHaving finished Cases 1 and 2, we may assume without loss of generality that we are in Case 3 or Case 4 below, where ${\\left\\{\\alpha,\\beta\\right\\}}\\in{\\left\\{0,1\\right\\}}$, $\\bar{\\alpha}=1-\\alpha$, $\\bar{\\beta}=1-\\beta$ and $a',b',c'\\in{\\left\\{0,1\\right\\}}^{k-2}$.\n\n[**Case 3: $a=(\\bar{\\alpha},\\bar{\\beta},a')$, $b=(\\bar{\\alpha},\\beta,b')$, $c=(\\alpha,\\bar{\\beta},c')$:$\\>$**]{} Since $R_{f^{1=*}}$ is affine and $a$, $b$ and $c$ are in $R_f$, we must have either $d=(\\alpha,\\beta,d')\\in R_f$ or $e=(\\bar{\\alpha},\\beta,d')\\in R_f$, where $d'=a'\\oplus b'\\oplus c'$. In the first case, we are done (we have contradicted the assumption that $d\\not\\in R_f$), so assume that $e\\in R_f$ but $d\\not\\in R_f$. Similarly, since $R_{f^{2=*}}$ is affine, we may assume that $g=(\\alpha,\\bar{\\beta},d')\\in R_f$. Since $R_{f^{1=\\bar{\\alpha}}}$ is affine and $a$, $b$ and $e$ are in $R_f$, we find that $h=a\\oplus b\\oplus e=(\\bar{\\alpha},\\bar{\\beta},c')\\in R_f$. Since $R_{f^{2=\\bar{\\beta}}}$ is affine and $a$, $c$ and $g$ are in $R_f$, we find that $i=(\\bar{\\alpha},\\bar{\\beta},b')\\in R_f$. Also, since $R_{f^{2=\\bar{\\beta}}}$ is affine and $a$, $h$ and $i$ are in $R_f$, we find that $j=(\\bar{\\alpha},\\bar{\\beta},d')\\in R_f$. Let $f'(r_1,r_2) = f(r_1,r_2,d_3,\\ldots,d_k)$. Since $e$, $g$ and $j$ are in $R_f$ but $d$ is not, we have $(\\bar{\\alpha},\\beta),(\\alpha,\\bar{\\beta}),(\\bar{\\alpha},\\bar{\\beta})\\in\nR_{f'}$, but $(\\alpha,\\beta)\\notin R_{f'}$. Thus, $f'$ does not have affine support and ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f'\\})$ is -hard by induction. ",
"Also, ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f'\\})\\redT{\\mbox{\\sf \\#CSP}\\xspace}(\\{f\\})$ by Lemma \\[lem:2pinning\\].",
"\n\n[**Case 4: $a=(\\bar{\\alpha},\\alpha,a')$, $b=(\\bar{\\alpha},\\alpha,b')$, $c=(\\alpha,\\bar{\\alpha},c')$:$\\>$**]{} Since $R_{f^{1=*}}$ is affine and $a$, $b$ and $c$ are in $R_f$ but $d$ is not, we have $e=(\\bar{\\alpha},\\bar{\\alpha},d')\\in R_f$. Similarly, since $R_{f^{2=*}}$ is affine and $a$, $b$ and $c$ are in $R_f$ but $d$ is not, we have $g=(\\alpha,\\alpha,d')\\in R_f$. Now since $R_{f^{1=\\bar{\\alpha}}}$ is affine and $a$, $b$ and $e$ are in $R_f$, we have $h=(\\bar{\\alpha},\\bar{\\alpha},c')\\in R_f$. Also, since $R_{f^{2={\\alpha}}}$ is affine and $a$, $b$ and $g$ are in $R_f$, we have $i=(\\alpha,\\alpha,c')\\in R_f$.\n\nLet $f'(r_1,r_2) = f(r_1,r_2,c_3,\\ldots,c_k)$. If $j=(\\bar{\\alpha},\\alpha,c')\\not\\in R_f$ then $f'$ does not have affine support (since $c$, $h$ and $i$ are in $R_f$) so we finish by induction as in Case 3. ",
"Suppose $j\\in R_f$. Since $R_{f^{1=\\bar{\\alpha}}}$ is affine and $a$, $b$ and $j$ are in $R_f$, we have $\\ell=(\\bar{\\alpha},\\alpha,d')\\in R_f$. Let $f''(r_1,r_2) = f(r_1,r_2,d_3,\\ldots,d_k)$. Then $f''$ does not have affine support (since $e$, $g$ and $\\ell$ are in $R_f$ but $d$ is not) so we finish by induction as in Case 3.",
"\n\nLemma \\[lem:CH\\] showed that ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f\\})$ is -hard when $f$ does not have affine support. ",
"The following lemma gives another (rather technical, but useful) condition which implies that ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f\\})$ is -hard. ",
"We start with some notation. ",
"Let $f$ be an arity-$k$ function. ",
"For a value $b\\in\\{0,1\\}$, an index $i\\in\\{1,\\ldots,k\\}$, and a tuple $y\\in\\{0,1\\}^{k-1}$, let $\\substuple{y}{i}{b}$ denote the tuple $x\\in\\{0,1\\}^k$ formed by setting $x_i=b$ and $x_j=y_j$ $(j\\in{\\left\\{1,\\ldots,k\\right\\}}\\setminus{\\left\\{i\\right\\}})$.\n\nWe say that index $i$ of $f$ is *useful* if there is a tuple $y$ such that $f(\\substuple{y}{i}{0})>0$ and $f(\\substuple{y}{i}{1})>0$. We say that $f$ is [*product-like*]{} if, for every useful index $i$, there is a rational number $\\lambda_i$ such that, for all $y\\in\\{0,1\\}^{k-1}$, $$\\label{condition}\nf(\\substuple{y}{i}{0})=\\lambda_i f(\\substuple{y}{i}{1}).$$ If every position $i$ of $f$ is useful then being product-like is the same as being of product type. ",
"However, being product-like is less demanding because it does not restrict indices that are not useful.",
"\n\n\\[hard\\] \\[four\\] If $f\\in \\mathcal{F}_2$ is not product-like then [\\#CSP]{}$(\\{f\\})$ is -hard.",
"\n\nWe’ll use Corollary \\[bulgro\\] to prove hardness, following an argument from [@dgp]. ",
"Choose a useful index $i$ so that there is no $\\lambda_i$ satisfying (\\[condition\\]).",
"\n\nSuppose $f$ has arity $k$. Let $A$ be the $2 \\times 2^{k-1}$ matrix such that for $b\\in\\{0,1\\}$ and $y\\in \\{0,1\\}^{k-1}$, $A_{b,y}=f(\\substuple{y}{i}{b})$. Let $A'=A A^T$.\n\nFirst, we show that [[Eval]{}]{}($A'$) is -hard. ",
"Note that $A'$ is the following symmetric $2\\times 2$ matrix with non-negative rational entries. ",
"$$\\left(\n\\begin{array}{cc}\n\\sum_y A_{0,y}^2 &\\sum_y A_{0,y}A_{1,y}\\\\\n\\sum_y A_{0,y}A_{1,y} & \\sum_y A_{1,y}^2\\\\\n\\end{array}\n\\right)\n=\n\\left(\n\\begin{array}{cc}\n\\sum_y {f(\\substuple{y}{i}{0})}^{2}\n &\\sum_y f(\\substuple{y}{i}{0})f(\\substuple{y}{i}{1})\\\\\n\\sum_y f(\\substuple{y}{i}{0})f(\\substuple{y}{i}{1})\n & \\sum_y f(\\substuple{y}{i}{1})^2\\\\\n\\end{array}\n\\right)$$ Since index $i$ is useful, all four entries of $A'$ are positive. ",
"To show that [[Eval]{}]{}($A'$) is -hard by Corollary \\[bulgro\\], we just need to show that its determinant is non-zero. ",
"By Cauchy-Schwartz, the determinant is non-negative, and is zero only if $\\lambda_i$ exists, which have assumed not to be the case. ",
"Thus [[Eval]{}]{}($A'$) is -hard by Corollary \\[bulgro\\].",
"\n\nNow we reduce [[Eval]{}]{}($A'$) to \\#CSP$(\\{f\\})$. To do this, take an undirected graph $G$ which is an instance of [[Eval]{}]{}($A'$). ",
"Construct an instance $Y$ of \\#CSP$(\\{f\\})$. For every vertex $v$ of $G$ we introduce a variable $x_v$ of $Y$. Also, for every edge $e$ of $G$ we introduce $k-1$ variables $x_{e,1},\\ldots,x_{e,{k-1}}$ of $Y$. We introduce constraints in $Y$ as follows. ",
"For each edge $e=(v,v')$ of $G$ we introduce constraints $f(x_v,x_{e,1},\\ldots,x_{e,k-1})$ and $f(x_{v'},x_{e,1},\\ldots,x_{e,k-1})$ into $Y$, where we have assumed, without loss of generality, that the first index is useful.",
"\n\nIt is clear that [[Eval]{}]{}($A'$) is exactly equal to the partition function of the \\#CSP$(\\{f\\})$ instance $Y$.\n\nFor $w\\in\\Rationals^+$, let $U_{w}$ denote the unary function mapping 0 to 1 and 1 to $w$. Note that $U_0=\\delta_0$, and $U_1$ gives the constant (0-ary function) 1, occurrences of which leave the partition function unchanged. ",
"So, by Lemma \\[lem:2pinning\\], we can discard these constraints since they do not add to the complexity of the problem. ",
"Note, by the observation above about proportional functions, that the functions $U_w$ include all unary functions except for $\\delta_1$ and the constant 0. ",
"We can discard $\\delta_1$ by Lemma \\[lem:2pinning\\], and if the constant 0 function is in $\\mathcal{F}$, any instance $I$ where it appears as a constraint has $Z(I)=0$. So again we can discard these constraints since they not add to the complexity of the problem.",
"\n\nThus $U_w$ will be called *nontrivial* if $w\\notin{\\left\\{0,1\\right\\}}$. Let $\\oplus_{k}:\\{0,1\\}^{k}\\to\\{0,1\\}$ be the arity-$k$ parity function that is 1 iff its argument has an odd number of $1$s. ",
"Let $\\neg\\oplus_{k}:\\{0,1\\}^{k}\\to\\{0,1\\}$ be the function $1-\\oplus_{k}$. The following lemma shows that even a simple function like $\\oplus_3$ can lead to intractable \\#CSP instances when it is combined with a nontrivial weight function $U_\\lambda$.\n\n${\\mbox{\\sf \\#CSP}\\xspace}(\\oplus_{3},U_{\\lambda},\\delta_0,\\delta_1)$ and ${\\mbox{\\sf \\#CSP}\\xspace}(\\neg\\oplus_{3},U_{\\lambda},\\delta_0,\\delta_1)$ are both -hard, for any positive $\\lambda\\neq 1$. \\[one\\]\n\nWe give a reduction from computing the Weight Enumerator of a Linear Code, which was shown to be -hard in Lemma \\[WE\\]. ",
"In what follows, it is sometimes convenient to view $\\oplus_{k}$, $\\delta_{0}$, etc., ",
"as relations as well as functions to ${\\left\\{0,1\\right\\}}$.\n\nWe first argue that for any $k$, the relation $\\oplus_k$ can be simulated by ${\\left\\{\\oplus_3, \\delta_0, \\delta_1\\right\\}}$. For example, to simulate $x_1 \\oplus \\cdots \\oplus x_k$ for $k>3$, take new variables $y$, $z$ and $w$ and let $m=\\lceil k/2 \\rceil$ and use $x_1 \\oplus \\cdots \\oplus x_m \\oplus y$ and $x_{m+1} \\oplus \\cdots \\oplus x_k \\oplus z$ and $y \\oplus z\\oplus w$ and $\\delta_0(w)$.\n\nSince ${\\left\\{\\oplus_3, \\delta_0, \\delta_1\\right\\}}$ can be used to simulate any relation $\\oplus_k$, we can use ${\\left\\{\\oplus_3, \\delta_0, \\delta_1\\right\\}}$ to simulate an arbitrary system of linear equations over $\\mathrm{GF}(2)$. In particular we can use them to simulate the subspace $\\Upsilon$ of code words for a given generating matrix $A$.",
"\n\nFinally, we can use $U_{\\lambda}$ to simulate the function which evaluates the weight enumerator on $\\Upsilon$. Then, since $\\lambda\\neq 0,1$, we can apply Lemma \\[WE\\] to complete the argument. ",
"The same proof, with minor modifications, applies to $\\neg\\oplus_3$.\n\nSuppose $f\\in\\mathcal{F}_2$ is not of product type. ",
"Then, for any positive $\\lambda\\neq 1$, there exists a constant $c$, depending on $f$, such that ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f,\\delta_0,\\delta_1,U_{\\lambda},U_{c}\\})$ is -hard. ",
"\\[two\\]\n\nIf $f$ does not have affine support, the result follows by Lemma \\[lem:CH\\]. ",
"So suppose $f$ has affine support. ",
"Consider the underlying relation $R_f$, viewed as a table. ",
"The rows of the table represent the tuples of the relation. ",
"Let $J$ be the set of columns on which the relation is not constant. ",
"That is, if $i\\in J$ then there is a row $x$ with $x_i=0$ and a row $y$ with $y_i=1$. Group the columns in $J$ into equivalence classes: two columns are equivalent iff they are equal or complementary. ",
"Let $k$ be the number of equivalence classes. ",
"Take one column from each of the $k$ equivalence classes as a representative, and focus on the arity-$k$ relation $R$ induced by those columns.",
"\n\n[**Case 1: Suppose $R$ is the complete relation of arity $k$.**]{}\\\nLet $f^*$ be the projection of $f$ onto the $k$ columns of $R$. By Lemma \\[lem:project\\], $${\\mbox{\\sf \\#CSP}\\xspace}(\\{f^*\\})\n\\, \\redT\\, {\\mbox{\\sf \\#CSP}\\xspace}(\\{f\\})\\, \\redT\\,\n{\\mbox{\\sf \\#CSP}\\xspace}(\\{f,\\delta_0,\\delta_1,U_{\\lambda},U_{c}\\}).\\vspace{-1.4ex}$$ We will argue that ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f^*\\})$ is -hard. ",
"To see this, note that every column of $f^*$ is useful. ",
"Thus, if $f^*$ were product-like, we could conclude that $f^*$ was of product type. ",
"But this would imply that $f$ is of product type, which is not the case by assumption. ",
"So $f^*$ is not product-like and hardness follows from Lemma \\[hard\\].",
"\n\n[**Case 2: Suppose $R$ is not the complete relation of arity $k$.**]{}\\\nWe had assumed that $R_f$ is affine. ",
"This means that given three vectors, $x$, $y$ and $z$, in $R_f$, $x\\xor y \\xor z$ is in $R_f$ as well. ",
"The arity-$k$ relation $R$ inherits this property, so is also affine.",
"\n\nChoose a minimal set of columns of $R$ that do not induce the complete relation. ",
"This exists by assumption. ",
"Suppose there are $j$ columns in this minimal set. ",
"Observe that $j\\neq 1$ because there are no constant columns in $J$. Also $j\\not=2$, since otherwise the two columns would be related by equality or disequality, contradicting the preprocessing step. ",
"The argument here is that on two columns, $R$ cannot have exactly three tuples because it is affine, and having tuples $x$, $y$ and $z$ in would require the fourth tuple $x\\xor y \\xor z$. But if it has two tuples then, because there are no constant columns, the only possibilities are either $(0,0)$ and $(1,1)$, or $(0,1)$ and $(1,0)$. Both contradict the preprocessing step, so $j\\geq3$.\n\nLet $R'$ be the restriction of $R$ to the $j$ columns. ",
"Now $R'$ of course has fewer than $2^j$ rows, and at least $2^{j-1}$ by minimality. ",
"It is affine, and hence must be $\\oplus_j$ or $\\neg\\oplus_j$. To see this, first note that the size of $R'$ has to be a power of $2$ since $R'$ is the solution to a system of linear equations. ",
"Hence the size of $R'$ must be $2^{j-1}$. Then, since there are $j$ variables, there can only be one defining equation. ",
"And, since every subset of $j-1$ variables induces a complete relation, this single equation must involve all variables. ",
"Therefore, the equation is $\\xor_j$ or $\\neg\\xor_j$.\n\nLet $f'$ be the projection of $f$ onto the $j$ columns just identified. ",
"Let $f''$ be further obtained by pinning all but three of the $j$ variables to 0. ",
"Pinning $j-3$ variables to $0$ leaves a single equation involving all three remaining variables. ",
"Thus $R_{f''}$ must be $\\xor_3$ or $\\neg \\xor_3$.\n\nNow define the symmetric function $f'''$ by $$f'''(a,b,c) =\nf''(a,b,c)\\*f''(a,c,b)\\*f''(b,a,c)\\*f''(b,c,a)\\*f''(c,a,b)\\*f''(c,b,a),\\vspace{-1.4ex}$$ Note that $R_{f'''}$ is $\\oplus_3$ or $\\neg\\oplus_3$, since $R_{f''}$ is symmetric and hence $R_{f'''}=R_{f''}$.\n\nTo summarise: using $f$ and the constant functions $\\delta_0$ and $\\delta_1$, we have simulated a function $f'''$ such that its underlying relation $R_{f'''}$ is either $\\oplus_3$ or $\\neg\\oplus_3$. Furthermore, if triples $x$ and $y$ have the same number of $1$s then $f'''(x)=f'''(y)$.\n\nWe can now simulate an unweighted version of $\\oplus_3$ or $\\neg\\oplus_3$ using $f'''$ and a unary function $U_c$, with $c$ set to a conveniently-chosen value. ",
"There are two cases. ",
"Suppose first that the affine support of $f'''$ is $\\neg\\xor_3$. Then let $w_{0}$ denote the value of $f'''$ when applied to the $3$-tuple $(0,0,0)$ and let $w_2$ denote $f'''(0,1,1)=f'''(1,0,1)=f'''(1,1,0)$. Recall that $f'''(x)=0$ for any other $3$-tuple $x$. Now let $c={(w_0/w_2)}^{1/2}$. Note from the definition of $f'''$ that $w_{0}$ and $w_{2}$ are squares of rational numbers, so $c$ is also rational. ",
"Define a function $g$ of arity 3 by $g(\\alpha,\\beta,\\gamma) =\nU_c(\\alpha)U_c(\\beta) U_c(\\gamma)f'''(\\alpha, \\beta, \\gamma)$. Note that $g(0,0,0)=w_0$ and $g(0,1,1)=g(1,0,1)=g(1,1,0) = c^2 w_2 = w_0$. Thus, $g$ is a pure affine function with affine support $\\neg\\xor_3$ and range $\\{0,w_0\\}$. The other case, in which the affine support of $f'''$ is $\\xor_3$, is similar.",
"\n\nWe have established a reduction from either ${\\mbox{\\sf \\#CSP}\\xspace}(\\oplus_{3},U_{\\lambda},\\delta_0,\\delta_1)$ or ${\\mbox{\\sf \\#CSP}\\xspace}(\\neg\\oplus_{3},U_{\\lambda},\\delta_0,\\delta_1)$, which are both -hard by Lemma \\[one\\].",
"\n\n\\[five\\] If $f\\in\\mathcal{F}_2$ is not of product type, then ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f,\\delta_0,\\delta_1,U_{\\lambda}\\})$ is -hard for any positive $\\lambda\\neq 1$.\n\nTake an instance $I$ of ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f,\\delta_0,\\delta_1,U_{\\lambda},U_{c}\\})$, from Lemma \\[two\\], with $n$ variables $x_1,x_2,\\ldots,x_n$. We want to compute the partition function $Z(I)$ using only instances of ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f,\\delta_0,\\delta_1,U_{\\lambda}\\})$. That is, instances which avoid using constraints $U_c$. For each $i$, let $m_{i}$ denote the number of copies of $U_{c}$ that are applied to $x_i$, and let $m=\\sum_{i=1}^n m_{i}$. Then we can write the partition function as $Z(I)=Z(I;c)$ where $$Z(I;w) = \\sum_{\\sigma\\in{\\{0,1\\}}^n}\n\\hat{Z}(\\sigma) \\prod_{i:\\sigma_{i}=1}w^{m_{i}}=\\sum_{\\sigma\\in{\\{0,1\\}}^n}\n\\hat{Z}(\\sigma) w^{\\sum_{i=1}^n m_{i}\\sigma_i},$$ where $\\hat{Z}(\\sigma)$ denotes the value corresponding to the assignment $\\sigma(x_i)=\\sigma_i$, ignoring constraints applying $U_c$, and $w$ is a variable. ",
"So $\\hat{Z}(\\sigma)$ is the weight of $\\sigma$, taken over all constraints other than those applying $U_{c}$. Note also that $Z(I;w)$ is a polynomial of degree $m$ in $w$. We can evaluate $Z(I;w)$ at the point $w=\\lambda^j$ by replacing each $U_c$ constraint with $j$ copies of a $U_\\lambda$ constraint. ",
"This evaluation is an instance of ${\\mbox{\\sf \\#CSP}\\xspace}({\\left\\{f,\\delta_0,\\delta_1,U_{\\lambda}\\right\\}})$. So, using $m$ different values of $j$ and interpolating, we learn the coefficients of the polynomial $Z(I;w)$. Then we can put $w=c$ to evaluate $Z(I)$.\n\n\\[six\\] Suppose $f\\in\\mathcal{F}_2$ is not of product type, and $g\\in\\mathcal{F}_2$ is not pure affine. ",
"Then ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f,g,\\delta_0,\\delta_1\\})$ is -hard.",
"\n\nIf $g$ does not have affine support we are done by Lemma \\[lem:CH\\]. ",
"So suppose that $g$ has affine support. ",
"Since $g$ is not pure affine, the range of $g$ contains at least two non-zero values.",
"\n\nThe high-level idea will be to use pinning and bisection to extract a non-trivial unary weight function $U_\\lambda$ from $g$. Then we can reduce from ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f,\\delta_0,\\delta_1,U_{\\lambda}\\})$, which we proved -hard in Lemma \\[five\\].",
"\n\nLook at the relation $R_g$, viewed as a table. ",
"If every column were constant, then $g$ would be pure affine, so this is not the case. ",
"Select a non-constant column with index $h$. If there are two non-zero values in the range of $g$ amongst the rows of $R_g$ that are $0$ in column $h$ then we derive a new function $g'$ by pinning column $h$ to $0$. The new function $g'$ is not pure affine, since the two non-zero values prevent this. ",
"So we will show inductively that ${\\mbox{\\sf \\#CSP}\\xspace}({\\left\\{f,g',\\delta_0,\\delta_1\\right\\}})$ is -hard. ",
"This will give the result since ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f,g',\\delta_0,\\delta_1\\})$ trivially reduces to ${\\mbox{\\sf \\#CSP}\\xspace}(\\{f,g,\\delta_0,\\delta_1\\})$.\n\nIf we don’t finish this way, or symmetrically by pinning column $h$ to $1$, then we know that there are distinct positive values $w_0$ and $w_1$ such that, for every row $x$ of $R_g$ with $0$ in column $h$, $g(x)=w_0$ and, for every row $x$ of $R_g$ with $1$ in column $h$, $g(x)=w_1$. Now note that, because the underlying relation $R_g$ is affine, it has the same number of $0$’s in column $h$ as $1$’s. ",
"This is because $R_g$ is the solution of a set of linear equations. ",
"Adding the equation $x_h=0$ or $x_h=1$ exactly halves the set of solutions in either case. ",
"We now project onto the index set ${\\left\\{h\\right\\}}$. We obtain the unary weight function $U_\\lambda$, with $\\lambda=w_1/w_0$, on using the earlier observation about proportional functions. ",
"This was our goal, and completes the proof.",
"\n\nLemma \\[seven\\] now follows from Lemma \\[lem:2pinning\\] and Lemma \\[six\\], completing the proof of Theorem \\[thm:main\\].",
"\n\n[1]{} G. Brightwell and P. Winkler, Graph homomorphisms and phase transitions, *Journal of Combinatorial Theory (Series B)* **77** (1999), 221–262\n\nA. Bulatov and V. Dalmau, Towards a dichotomy theorem for the counting constraint satisfaction problem, in *Proc. ",
"Annual IEEE Symposium on Foundations of Computer Science*, 2003, pp. ",
"562–573.",
"\n\nD. Cohen, M. Cooper, P. Jeavons and A. Krokhin, The complexity of soft constraint satisfaction, *Artificial Intelligence* **170** (2006), 983–1016.",
"\n\nA. Bulatov and M. Grohe, The complexity of partition functions, *Theoretical Computer Science* **348** (2005), 148–186.",
"\n\nB. Cipra, An Introduction to the Ising Model, *American Mathematical Monthly* **94** (1987), 937–959.",
"\n\nN. Creignou and M. Hermann, Complexity of generalized satisfiability counting problems, *Information and Computation* **125** (1996), 1–12.",
"\n\nN. Creignou, S. Khanna, M. Sudan, *Complexity classifications of Boolean constraint satisfaction problems*, SIAM Press, 2001.",
"\n\nand C. Greenhill, The complexity of counting graph homomorphisms, *Random Structures and Algorithms* **17** (2000), 260–289.",
"\n\n, [L.A. Goldberg]{} and M. Paterson, On counting homomorphisms to directed acyclic graphs, in *Proc. ",
"International Colloquium on Automata, Languages and Programming*, Lecture Notes in Computer Science [ **4051**]{}, Springer, 2006, pp. ",
"38–49.",
"\n\nT. Feder and M. Vardi, The computational structure of monotone monadic [SNP]{} and constraint satisfaction: a study through [D]{}atalog and group theory, *SIAM Journal on Computing* **28** (1999), 57–104.",
"\n\nL.A. Goldberg and M. Jerrum, Inapproximability of the Tutte polynomial, <http://arxiv.org/abs/cs.CC/0605140>, 2006.",
"\n\nC. Greenhill, The complexity of counting colourings and independent sets in sparse graphs and hypergraphs, *Computational Complexity* **9** (2000), 52–72.",
"\n\nP. Hell and J. Nešetřil, On the complexity of $H$-coloring, *Journal of Combinatorial Theory (Series B)* **48** (1990), 92–110.",
"\n\nP. Hell and J. Nešetřil, *Graphs and homomorphisms*, Oxford University Press, 2004.",
"\n\nL. Lovász, Operations with structures, *Acta Mathematica Hungarica* **18** (1967), 321–328.",
"\n\nR. Ladner, On the structure of polynomial time reducibility, *Journal of the Association for Computing Machinery* **22** (1975), 155–171.",
"\n\nC. Papadimitriou, *Computational complexity*, Addison-Wesley, 1994.",
"\n\nF. Rossi, P. van Beek and T. Walsh (Eds.), *",
"Handbook of constraint programming*, Elsevier, 2006.",
"\n\nT. Schaefer, The complexity of satisfiability problems, in *Proc. ",
"Annual ACM Symposium on Theory of Computing*, ACM Press, 1978, pp. ",
"216–226.",
"\n\nA. Scott and G. Sorkin, Polynomial constraint satisfaction: a framework for counting and sampling CSPs and other problems, <http://arxiv.org/abs/cs/0604079>.",
"\n\nJ. Schwartz, Fast probabilistic algorithms for verification of polynomial identities, *Journal of the Association for Computing Machinery* **27** (1980), 701–717.",
"\n\nL. Valiant, The complexity of enumeration and reliability problems, *SIAM Journal on Computing* **8** (1979), 410–421.",
"\n\nD. Welsh, [*Complexity: knots, colourings and counting*]{}, LMS Lecture Note Series, vol.",
" 186, Cambridge University Press, 1993.",
"\n\nAppendix\n========\n\nThe purpose of this appendix is to prove Lemma \\[lem:pinning\\] for an arbitrary fixed domain $[q]$. We used only the special case $q=2$, which we stated and proved as Lemma \\[lem:2pinning\\]. ",
"However, pinning appears to be a useful technique for studying the complexity of , so we give a proof of the general Lemma \\[lem:pinning\\], which we believe will be applicable elsewhere.",
"\n\nFor every $\\mathcal{F}\\subseteq \\mathcal{F}_q$, ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F}\\cup \\bigcup_{c\\in[q]}\\delta_c) \\redT {\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F})$.\n\nIn order to prove the lemma, we introduce a useful, but less natural, variant of . ",
"Suppose $\\mathcal{F}\\subseteq \\mathcal{F}_q$. An instance $I$ of ${\\mbox{\\sf \\#CSP}\\xspace}^{\\neq}(\\mathcal{F})$ consists of a set $V$ of variables and a set $\\mathcal{C}$ of constraints, just like an instance of ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F})$. In addition, the instance may contain a *single* extra constraint $C$ applying the arity-$q$ *disequality* relation $\\chi_{\\neq}$ with scope $(v_{C,1},\\ldots,v_{C,q})$.\n\nThe disequality relation $\\chi_{\\neq}$ is defined by $\\chi_{\\neq}(x_1,\\ldots,x_q)=1$ if $x_1,\\ldots,x_q\\in[q]$ are pairwise distinct. ",
"That is, if they are a permutation of the domain $[q]$. Otherwise, $\\chi_{\\neq}(x_1,\\ldots,x_q)=0$.\n\nLemma \\[lem:pinning\\] follows immediately from Lemma \\[lem:first\\] and \\[lem:second\\] below.",
"\n\n\\[lem:first\\] For every $\\mathcal{F}\\subseteq \\mathcal{F}_q$, ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F}\\cup \\bigcup_{c\\in[q]}\\delta_c) \\redT{\\mbox{\\sf \\#CSP}\\xspace}^{\\neq}(\\mathcal{F})$.\n\nWe follow the proof lines of Lemma \\[lem:2pinning\\], but instead of subtracting the contribution corresponding to configurations in which some $t_i$’s get the same value, we use the disequality relation to restrict the partition function to configurations in which they get distinct values.",
"\n\nSay that $\\mathcal{F}$ is *symmetric* if it is the case that for every arity-$k$ function $f\\in\\mathcal{F}$ and every tuple $x\\in[q]^k$ and every permutation $\\pi:[q]\\rightarrow[q]$, $f(x_1,\\ldots,x_k) = f(\\pi(x_1),\\ldots,\\pi(x_k))$.\n\nLet $I$ be an instance of ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F}\\cup \\bigcup_{c\\in[q]}\\delta_c)$ with variable set $V$. Let $V_c$ be the set of variables $v\\in V$ to which the constraint $\\delta_c(v)$ is applied. ",
"Assume without loss of generality that the sets $V_c$ are pairwise disjoint. ",
"Let $V_{q}=V \\setminus\\bigcup_{c\\in[q]} V_c$. We construct an instance $I'$ of ${\\mbox{\\sf \\#CSP}\\xspace}^{\\neq}(\\mathcal{F})$. The instance has variables $V_q \\cup \\{t_0,\\ldots,t_{q-1}\\}$. Every constraint $C$ of $I$ involving a function $f\\in\\mathcal{F}$ corresponds to a constraint $C'$ of $I'$. Here $C'$ is the same as $C$ except that variables in $V_c$ are replaced with $t_c$, for each $c\\in[q]$. Also, we add a new disequality constraint to the new variables $t_0,\\ldots,t_{q-1}$.\n\n[**Case 1. ",
"$\\mathcal{F}$ is symmetric:**]{}\n\nBy construction, $Z(I')= \\sum_{y_0,\\ldots,y_{q-1}} Z(I'\\mid\n\\sigma(t_0)=y_0,\\ldots,\\sigma(t_{q-1})=y_{q-1})$, where the sum is over all permutations $y_0,\\ldots,y_{q-1}$ of $[q]$. By symmetry, the summands are all the same, so $Z(I') = q! ",
"Z(I' \\mid \\sigma(t_0)=0,\\ldots,\\sigma(t_{q-1})=q-1) =\nq! ",
"Z(I)$.\n\n[**Case 2. ",
"$\\mathcal{F}$ is not symmetric:**]{}\n\nSay that two permutations $\\pi_1:[q]\\rightarrow[q]$ and $\\pi_2:[q]\\rightarrow[q]$ are *equivalent* if, for every $f\\in\\mathcal{F}$ and every tuple $x\\in[q]^k$, $f(\\pi_1(x_1),\\ldots,\n\\pi_1(x_k)) = f(\\pi_2(x_1),\\ldots,\\pi_2(x_k))$. Partition the permutations $\\pi:[q]\\rightarrow[q]$ into equivalence classes. ",
"Let $h$ be the number of equivalence classes and $n_i$ be the size of the $i$’th equivalence class, so $n_1 + \\cdots + n_h=q!$.[^6] Let $\\{\\pi_1,\\ldots,\\pi_h\\}$ be a set of representatives of the equivalence classes with $\\pi_1$ being the identity. ",
"We know that $n_1\\neq q!$ since $\\mathcal{F}$ is not symmetric.",
"\n\nFor a positive integer $\\ell$ we will now build an instance $I'_\\ell$ by adding new constraints to $I'$. For each $\\pi_i$ other than $\\pi_1$ we add constraints as follows. ",
"Choose a function $f_i\\in\\mathcal{F}$ and a tuple $y$ such that $f_i(y_1,\\ldots,y_k)\\neq f_i(\\pi_i(y_1),\\ldots,\\pi_i(y_k))$. If $f_i(y_1,\\ldots,y_k)> f_i(\\pi_i(y_1),\\ldots,\\pi_i(y_k))$ then define the $k$-tuple $x^i$ by $(x^i_1,\\ldots,x^i_k)\n=(y_1,\\ldots,y_k)$. Otherwise, let $n$ be the order of the permutation $\\pi_i$ and let $g_r$ denote $f_i(\\pi_i^r(y_1),\\ldots,\\pi_i^r(y_k))$. Since $g_0<g_1$ and $g_n=g_0$ there exists a $\\xi\\in\\{1,\\ldots,n-1\\}$ such that $g_\\xi>g_{\\xi+1}$. Let $(x^i_1,\\ldots,x^i_k)=(\\pi^{\\xi}(y_1),\\ldots,\\pi^{\\xi}(y_k))$ so $f_i(x^i_1,\\ldots,x^i_k)> f_i(\\pi_i(x^i_1),\\ldots,\\pi_i(x^i_k))$.\n\nLet $w_{ij}$ denote $f_i(\\pi_j(x^i_1),\\ldots,\\pi_j(x^i_k))$ so, since $\\pi_1$ is the identity, we have just ensured that $w_{i1}>w_{ii}$. Let $s^i=(t_{x_1^i},\\ldots,t_{x_k^i})$, and let $0\\leq z_i\\leq h$ $(i=2,\\ldots,h)$ be positive integers, which we will determine below. ",
"Add $\\ell z_i$ new constraints to $I'_\\ell$ with relation $f_i$ and scope $s^i$. Let $\\lambda_i = \\prod_{\\gamma=2}^h w_{\\gamma i}^{z_\\gamma}$. Note that, given $\\sigma(t_0)=\\pi_i(0),\\ldots,\\sigma(t_{q-1})=\\pi_i(q-1)$, the contribution to $Z(I'_\\ell)$ for the new constraints is $$\\prod_{\\gamma=2}^h f_\\gamma(\\sigma(t_{x^\\gamma_1}),\\ldots,\\sigma(t_{x^\\gamma_k}))^{z_\\gamma \\ell}=\n\\prod_{\\gamma=2}^h f_\\gamma(\\pi_i(x^\\gamma_1),\\ldots,\\pi_i(x^\\gamma_k))^{z_\\gamma \\ell}=\n\\prod_{\\gamma=2}^h w_{\\gamma,i}^{z_\\gamma \\ell}\n= \\bigg(\\prod_{\\gamma=2}^h w_{\\gamma,i}^{z_{\\gamma}} \\bigg)^\\ell=\n{\\lambda_i}^\\ell.$$ So $$Z(I'_\\ell) = \\sum_{i=1}^h n_i\\,\nZ(\\,I'\\mid \\sigma(t_0)=\\pi_i(0),\\ldots,\\sigma(t_{q-1})=\\pi_i(q-1)\\,)\n\\,\\lambda_i^\\ell.$$\n\nWe have ensured that $\\lambda_1>0$, since $w_{i1}>w_{ii}\\geq 0$, so $w_{i1}>0$ for all $i=2,\\ldots,h$. We now choose the $z_i$’s so that $\\lambda_i\\neq \\lambda_1$ for all $i=2,\\ldots,h$. If $w_{\\gamma i}=0$ for any $\\gamma=2,\\ldots,h$, we have $\\lambda_i=0$ and hence $\\lambda_i\\neq\\lambda_1$. Thus we will assume, without loss of generality, that $w_{\\gamma i}>0$ for all $\\gamma=2,\\ldots,h$ and $i=2,\\ldots,h'$, where $h'\\leq h$. Then we have $$\\frac{\\lambda_i}{\\lambda_1}\\ =\\ \\prod_{\\gamma=2}^h \\Big(\\frac{w_{\\gamma i}}{w_{\\gamma 1}}\\Big)^{z_\\gamma}\\ =\\ e^{\\sum_{\\gamma=2}^h\\alpha_{\\gamma i}z_\\gamma}\n\\qquad (i=2,\\ldots,h'),$$ where $\\alpha_{\\gamma i}=\\ln(w_{\\gamma i}/w_{\\gamma 1})$. Note that $\\alpha_{ii}< 0$, since $w_{ii}<w_{i1}$. We need to find an integer vector $z=(z_2,\\ldots,z_h)$ so that none of the linear forms $\\mathcal{L}_i(z)=\\sum_{\\gamma=2}^h\\alpha_{\\gamma i}z_\\gamma$ is zero, for $i=2,\\ldots,h'$. We do this using a proof method similar to the Schwartz-Zippel Lemma. (",
"See, for example, [@Schwar80].) ",
"None of the $\\mathcal{L}_i(z)$ is identically zero, since $\\alpha_{ii}\\neq 0$. Consider the integer vectors $z\\in[h]^{h-1}$. At most $h^{h-2}$ of these can make $\\mathcal{L}_i(z)$ zero for any $i$, since the equation $\\mathcal{L}_i(z)=0$ makes $z_i$ a linear function of $z_\\gamma$ ($\\gamma\\neq i$). ",
"Therefore there are at most $(h'-1)h^{h-2}<h^{h-1}$ such $z$ which make any $\\mathcal{L}_i(z)$ zero. ",
"Therefore there must be a vector $z\\in[h]^{h-1}$ for which none of the $\\mathcal{L}_i(z)$ is zero, and this is the vector we require.",
"\n\nNow, by combining terms with equal $\\lambda_i$ and ignoring terms with $\\lambda_i=0$, we can view $Z(I'_\\ell)$ as a sum $Z(I'_\\ell) = \\sum_i c_i \\lambda_i^{\\ell}$ where the $\\lambda_i$’s are positive and pairwise distinct and $$c_1 = n_1 Z(I'\\mid \\sigma(t_0)=0,\\ldots,\\sigma(t_{q-1})=q-1).$$ Thus, by Lemma 3.2 of [@DG] we can interpolate to recover $c_1$. Dividing by $n_1$, we get $$Z(I'\\mid \\sigma(t_0)=0,\\ldots,\\sigma(t_{q-1})=q-1)=Z(I).\\qedhere$$\n\nFor every $\\mathcal{F}\\subseteq \\mathcal{F}_q$, ${\\mbox{\\sf \\#CSP}\\xspace}^{\\neq}(\\mathcal{F}) \\redT {\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F})$. \\[lem:second\\]\n\nWe use Möbius inversion for posets, following the lines of the proof of [@BD Theorem 8].[^7] Consider the set of partitions of $[q]$. Let $\\underline{0}$ denote the partition with $q$ singleton classes. ",
"Consider the partial order in which $\\eta\\leq \\theta$ iff every class of $\\eta$ is a subset of some class of $\\theta$. Define $\\mu(\\underline{0})=1$ and for any $\\theta\\neq \\underline{0}$ define $\\mu(\\theta)=-\\sum_{\\eta\\leq \\theta,\\eta\\neq\\theta} \\mu(\\eta)$. Consider the sum $\\sum_{\\eta \\leq \\theta} \\mu(\\eta)$. Clearly, this sum is $1$ if $\\theta=\\underline{0}$. From the definition of $\\mu$, it is also easy to see that the sum is $0$ otherwise, since $$\\sum_{\\eta \\leq \\theta} \\mu(\\eta) = \\mu(\\theta)+\n\\sum_{\\eta \\leq \\theta,\\eta\\neq \\theta} \\mu(\\eta)\n=0.$$\n\nNow let $I$ be an instance of $ {\\mbox{\\sf \\#CSP}\\xspace}^{\\neq}(\\mathcal{F})$ with a disequality constraint applied to variables $t_0,\\ldots,t_{q-1}$. Let $V$ be the set of variables of $I$. Given a configuration $\\sigma:V \\rightarrow[q]$, let $\\vartheta(\\sigma)$ be the partition of $[q]$ induced by of $(\\sigma(t_0),\\ldots,\\sigma(t_{q-1}))$. Thus $i$ and $j$ in $[q]$ are in the same class of $\\vartheta(\\sigma)$ iff $\\sigma(t_i)=\\sigma(t_j)$. We say that a partition $\\eta$ is consistent with $\\sigma$ (written $\\eta \\preccurlyeq \\sigma$) if $\\eta\\leq \\vartheta(\\sigma)$. Note that $\\eta \\preccurlyeq \\sigma$ means that for any $i$ and $j$ in the same class of $\\eta$, $\\sigma(t_i)=\\sigma(t_j)$.\n\nLet $\\Omega$ be the set of configurations $\\sigma$ that satisfy all constraints in $I$ except possibly the disequality constraint. ",
"Then $Z(I)=\\sum_{\\sigma\\in\\Omega} w(\\sigma) \\mathds{1}_\\sigma$, where $\\mathds{1}_\\sigma=1$ if $\\sigma$ respects the disequality constraint, meaning that $\\vartheta(\\sigma)=\n\\underline{0}$, and $\\mathds{1}_\\sigma=0$ otherwise. ",
"By the Möbius inversion formula derived above, $$Z(I)\\,=\\,\\sum_{\\sigma\\in\\Omega} w(\\sigma)\n\\sum_{\\eta \\leq \\vartheta(\\sigma)} \\mu(\\eta).$$ Changing the order of summation, we get $$Z(I)\\,=\\,\\sum_{\\eta} \\mu(\\eta) \\sum_{\\eta\\leq \\theta}\\hspace{1pt}\n\\sum_{\\sigma\\in \\Omega:\\vartheta(\\sigma)=\\theta} w(\\sigma)\\,=\\,\n\\sum_{\\eta} \\mu(\\eta) \\sum_{\\sigma\\in \\Omega: \\eta \\preccurlyeq \\sigma}\nw(\\sigma).$$\n\nNow note that $\\sum_{\\sigma: \\eta \\preccurlyeq \\sigma} w(\\sigma)$ is the partition function $Z(I_\\eta)$ of an instance $I_\\eta$ of ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F})$. The instance $I_\\eta$ is formed from $I$ by ignoring the disequality constraint, and identifying variables in $t_0,\\ldots,t_{q-1}$ whose indices are in the same class of $\\eta$. Thus we can compute all the $Z(I_\\eta)$ in ${\\mbox{\\sf \\#CSP}\\xspace}(\\mathcal{F})$. Finally, $Z(I) = \\sum_{\\eta} \\mu(\\eta) Z(I_\\eta)$, completing the reduction.",
"\n\n[^1]: Usually $[q]$ is defined to be ${\\left\\{1,2,\\ldots,q\\right\\}}$, but it is more convenient here to start the enumeration of domain elements at 0 rather than 1.",
"\n\n[^2]: We assume $0\\in\\mathbb{N}$, so we allow non-negative constants.",
"\n\n[^3]: This is not quite the original statement of the theorem. ",
"We have chosen here to restrict all inputs to be rational, in order to avoid issues of how to represent, and compute with, arbitrary real numbers.",
"\n\n[^4]: A more general disequality function is defined in the Appendix.",
"\n\n[^5]: It is not necessary to choose this particular ordering for $J$, but it is convenient to do so.",
"\n\n[^6]: In fact, it can be shown that these equivalence classes are cosets of the symmetry group of $f$, and hence are of equal size, though we do not use this fact here.",
"\n\n[^7]: Lovász [@Lovasz67] had previously used Möbius inversion in a similar context.",
"\n"
] |
{
"pile_set_name": "ArXiv"
}
|
[
0,
0,
0,
0.0033783783783783786,
0.0075528700906344415,
0,
0,
0,
0,
0,
0.005649717514124294,
0,
0.01652892561983471,
0,
0,
0,
0,
0,
0,
0,
0.004484304932735426,
0.03225806451612903,
0,
0,
0.013513513513513514,
0,
0,
0,
0,
0.002564102564102564,
0,
0,
0,
0,
0.008064516129032258,
0.008403361344537815,
0,
0,
0,
0.024390243902439025,
0,
0,
0,
0,
0.013422818791946308,
0.01282051282051282,
0,
0,
0,
0.01098901098901099,
0,
0.011320754716981131,
0,
0,
0,
0,
0,
0.015503875968992248,
0.005434782608695652,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0.010416666666666666,
0.022988505747126436,
0.013937282229965157,
0,
0,
0,
0,
0,
0,
0.010869565217391304,
0,
0.008928571428571428,
0.00881057268722467,
0,
0,
0.007874015748031496,
0.0030349013657056147,
0.002570694087403599,
0.010638297872340425,
0,
0.0029498525073746312,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0.016853932584269662,
0.061224489795918366,
0,
0,
0,
0,
0,
0.006024096385542169,
0,
0.009523809523809525,
0.005494505494505495,
0.0024330900243309003,
0.016666666666666666,
0.006535947712418301,
0,
0,
0,
0.00546448087431694,
0.011904761904761904,
0,
0,
0,
0,
0.004878048780487805,
0,
0,
0,
0,
0.008264462809917356,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0.02054794520547945,
0.023809523809523808,
0.006578947368421052,
0.01098901098901099,
0,
0.016666666666666666,
0.005434782608695652,
0.004796163069544364,
0.005208333333333333,
0.00847457627118644,
0,
0.0049261083743842365,
0.0024154589371980675,
0,
0.0056657223796034,
0.0078125,
0.025806451612903226,
0.008421052631578947,
0,
0.001321003963011889,
0,
0,
0,
0,
0.006172839506172839,
0,
0.0125,
0,
0,
0,
0,
0.005555555555555556,
0,
0,
0,
0.0041841004184100415,
0,
0.006711409395973154,
0,
0.009174311926605505,
0.006802721088435374,
0.008547008547008548,
0.0040650406504065045,
0,
0,
0,
0.0017452006980802793,
0.00390625,
0,
0.005263157894736842,
0.004555808656036446,
0.004219409282700422,
0,
0.011363636363636364,
0.007159904534606206,
0,
0.004761904761904762,
0.00324254215304799,
0,
0.0012062726176115801,
0,
0,
0,
0,
0,
0.002785515320334262,
0,
0,
0.011494252873563218,
0,
0,
0,
0.0023148148148148147,
0,
0.007575757575757576,
0,
0,
0,
0.013392857142857142,
0,
0.008333333333333333,
0,
0.0038022813688212928,
0,
0.0017241379310344827,
0,
0.0036900369003690036,
0,
0,
0,
0.011627906976744186,
0,
0,
0,
0,
0.004975124378109453,
0,
0.006993006993006993,
0.009900990099009901,
0,
0,
0,
0.014285714285714285,
0,
0,
0.014492753623188406,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0.002621231979030144,
0,
0,
0.005405405405405406,
0.004310344827586207,
0.005797101449275362,
0,
0,
0.028985507246376812,
0.014084507042253521,
0,
0,
0.003875968992248062,
0,
0,
0,
0.017857142857142856,
0.0017482517482517483,
0,
0,
0.005208333333333333,
0,
0.00819672131147541,
0.015151515151515152,
0,
0,
0,
0,
0,
0,
0.007874015748031496,
0.015873015873015872,
0,
0.007407407407407408,
0,
0,
0.03418803418803419,
0,
0.015503875968992248,
0.023529411764705882,
0.021505376344086023,
0.007194244604316547,
0.028985507246376812,
0.021739130434782608,
0,
0,
0.014925373134328358,
0,
0.012578616352201259,
0.006097560975609756,
0,
0,
0.02564102564102564,
0.009433962264150943,
0.005376344086021506,
0.00398406374501992,
0,
0.0051813471502590676,
0.0020920502092050207,
0,
0,
0,
0.003663003663003663,
0,
0,
0,
0,
0,
0,
0.0033632286995515697,
0.006980802792321117,
0.03125,
0,
0,
0,
0.006127450980392157,
0.002867383512544803,
0,
0.0044004400440044,
0.006024096385542169,
0,
0,
0,
0,
0,
0,
0.011764705882352941,
0
] | 0.003803
| 5
|
[
"Pop Up: Madonna And Elton John Legitimately End Their Feud\n\nAlright people, it seems like the end of the feud between Madonna and Elton John is legit.",
"\n\nAccording to The Sun, the two entertainers met at a restaurant in Nice, France and ended their feud. ",
"A source said, “Elton goes to the Petite Maison for dinner fairly regularly as it’s near his villa in Mont Boron. ",
"But Madonna was also there for a bite before her show, which was down the road and didn’t start until around 10:30 PM.”",
"\n\nThe source added, “Just as he was leaving, he went over to talk to Madonna and they were laughing and smiling. ",
"They even hugged each other.”"
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0.02,
0.009708737864077669,
0.008771929824561403,
0.008403361344537815,
0.008849557522123894,
0
] | 0.009289
| 5
|
[
"2019 CALENDAR\n\nMy four-legged friends at their favorite local spots. ",
"It was an absolute joy to work with these critters and experience Asheville through their eyes. ",
"We all know the camera loves them, and I couldn’t have asked for a more professional group of models. ",
"We hope you enjoy the new year with our amazing animals and beautiful city!",
"\n\nAvailable now at Pet Vet on Patton, Asheville Humane Society, and Ben’s Tune-Up"
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0,
0.010416666666666666,
0,
0,
0.024691358024691357
] | 0.007022
| 5
|
[
"Increased catabolism of nucleic acid in nonalcoholic fatty liver disease patients of different ages.",
"\nUric acid is the end product of nucleic acid catabolism for humanity. ",
"Serum uric acid level has been suggested to be associated with nonalcoholic fatty liver disease (NAFLD). ",
"This study aims to examine the association between serum uric acid levels and NAFLD in subjects of different ages. ",
"A cross-sectional study was performed among the patients of different ages with NAFLD (abnormal group) or without NAFLD (normal group) in Lianyungang, Jiangsu, China. ",
"The levels of serum uric acid, total cholesterol, triglyceride, and low density lipoprotein in the abnormal group were significantly higher than those in the normal group, while the level of high density lipoprotein in the abnormal group was significantly lower than that in the normal group (p<0.05). ",
"The serum uric acid prevalence, total cholesterol, triglyceride, high density lipoprotein, and low density lipoprotein in the abnormal group was significantly higher than those in the normal group (p<0.05). ",
"The serum uric acid, total cholesterol, triglyceride, and low density lipoprotein levels and prevalence rates in elderly patients were higher than younger and middle aged patients. ",
"Serum uric acid level is highly associated with NAFLD in patients of different ages."
] |
{
"pile_set_name": "PubMed Abstracts"
}
|
[
0,
0.014084507042253521,
0.009523809523809525,
0.008695652173913044,
0.005988023952095809,
0,
0,
0,
0.011904761904761904
] | 0.005577
| 5
|
[
"1. ",
"Introduction {#sec1-marinedrugs-17-00149}\n===============\n\n*Ecklonia cava*, which is edible seaweed belonging to the Laminariaceae family, is found in Asian countries, such as Japan and Korea. *",
"E. cava* is a nutrient-dense food and it contains many types of organic compounds, including fucoidan and phlorotannins \\[[@B1-marinedrugs-17-00149]\\], which have various biological activities, such as antioxidant \\[[@B2-marinedrugs-17-00149],[@B3-marinedrugs-17-00149]\\], anti-allergic \\[[@B4-marinedrugs-17-00149]\\], anti-plasmin inhibitory \\[[@B5-marinedrugs-17-00149]\\], anticancer \\[[@B6-marinedrugs-17-00149]\\], antihypertensive \\[[@B7-marinedrugs-17-00149]\\], and elastase and hyaluronidase inhibitory effects \\[[@B8-marinedrugs-17-00149]\\], as well as strong antiviral activity against porcine epidemic diarrhea virus (PEDV) (a coronavirus) \\[[@B9-marinedrugs-17-00149]\\].",
"\n\nInfluenza, similar to coronaviruses, is also a contagious viral infection that causes acute respiratory illnesses and rapidly spreads through outbreaks \\[[@B10-marinedrugs-17-00149],[@B11-marinedrugs-17-00149]\\]. ",
"The influenza virus belongs to the Orthomyxoviridae family, and there are three different types: A, B, and C. Among them, types A and B are of great concern as human pathogens and result in seasonal or interpandemic epidemics as well as global pandemics, such as those that are caused by influenza A viruses \\[[@B12-marinedrugs-17-00149],[@B13-marinedrugs-17-00149]\\]. ",
"Over the past 100 years, four pandemics have been reported: H1N1 Spanish influenza (1918), H2N2 Asian influenza (1957), H3N2 Hong Kong influenza (1968), and recently, 2009 H1N1 (H1N1pdm09), which are all caused by influenza A viruses \\[[@B12-marinedrugs-17-00149],[@B14-marinedrugs-17-00149]\\]. ",
"In each pandemic, the number of novel virus strains arose and spread through human communities, leading to the substantial morbidity and mortality related to bacterial pneumonia \\[[@B11-marinedrugs-17-00149],[@B15-marinedrugs-17-00149]\\]. ",
"The influenza A viruses are single-stranded negative-sense RNA viruses that are subtyped on the basis of the composition of their two surface glycoproteins: hemagglutinin (HA) and neuraminidase (NA) \\[[@B16-marinedrugs-17-00149]\\]. ",
"The genome of influenza A viruses comprises 8 separated gene segments encoding 16 proteins and is surrounded by a liquid envelope \\[[@B17-marinedrugs-17-00149],[@B18-marinedrugs-17-00149]\\]. ",
"Two glycoproteins, HA and NA, are found in the viral envelopes, and these are considered to be the basis of antigenicity. ",
"HA initiates the infection of influenza virus by binding to the α-2,6-linked sialic acid and/or α-2,3-linked sialic acid receptors on the surface of the host cell, followed by receptor-mediated endocytosis of the virion into the cell \\[[@B17-marinedrugs-17-00149],[@B19-marinedrugs-17-00149]\\]. ",
"The NA protein serves as a sialidase, and it cleaves the link between the sialic acid and the HA protein to release the virus particles \\[[@B11-marinedrugs-17-00149],[@B19-marinedrugs-17-00149]\\]. ",
"To date, the Food and Drug Administration (FDA) \\[[@B20-marinedrugs-17-00149]\\] have approved only three drugs: Tamiflu (oseltamivir phosphate), Relenza (zanamivir), and Rapivab (peramivir).",
"\n\nDereplication is the term that is used to discover new natural materials through the rapid identification of compounds that are based on new analytical tools, such as MS and NMR spectroscopy, to avoid the re-isolation of known components. ",
"In particular, the rapid development of modern MS techniques has accelerated dereplication strategies using high-performance liquid chromatography---quadrupole time-of-flight mass (HPLC-qTOFMS) spectra with tandem database searching to identify the known compounds in the extract \\[[@B21-marinedrugs-17-00149]\\]. ",
"By increasing the use of high-resolution mass spectrometry (HRMS) for measuring exact masses, the concept of \"mass defect\" is also increasingly being used in natural products research \\[[@B22-marinedrugs-17-00149]\\]. ",
"The mass defect is calculated as the deviation between the exact mass and the nominal mass (integer-rounded mass) of a compound \\[[@B22-marinedrugs-17-00149],[@B23-marinedrugs-17-00149]\\]. ",
"Several methods have been developed to simplify the use of mass defects, including Kendrick mass defects, mass defect filtering, and fractional mass, which have played an important role in identifying many previously unknown compounds. ",
"In addition, a relative mass defect (RMD), calculated as (mass defect/measured monoisotopic mass) × 10^6^ in ppm, was recently introduced \\[[@B23-marinedrugs-17-00149],[@B24-marinedrugs-17-00149]\\]. ",
"The RMD remains constant for classes that share the same fractional hydrogen content, which is useful in classifying the compounds into groups with the same skeleton \\[[@B23-marinedrugs-17-00149]\\]. ",
"While fatty acids or hydrocarbons with high hydrogen contents show high RMDs (400 to 600 ppm), the values for polyphenolic metabolites are often less than 300 ppm due to their high oxygen contents \\[[@B23-marinedrugs-17-00149]\\]. ",
"In addition to modern techniques, such as HPLC-qTOFMS, classical bio-guided isolation has played an important role in the primary bioactive screening and identification of potential natural products. ",
"Pre-fractionation has recently been applied in bioactivity-guided isolations as an important step in obtaining bioactive materials. ",
"This is because the activities of minor components can be masked or decreased by more abundant inactive compounds in the total extract \\[[@B25-marinedrugs-17-00149]\\]. ",
"The combination of bio-guided isolation and dereplication enables the rapid and effective identification of the potential bioactive compounds \\[[@B26-marinedrugs-17-00149]\\].",
"\n\nThe aim of the present study was to develop a new antiviral agent from *E. cava*. ",
"Specifically, we want to develop dereplication methods, including classification that is based on RMD and HPLC-qTOFMS, to accurately and rapidly identify bioactive phlorotannin-type compounds in *E. cava*, as well as to easily target new compounds.",
"\n\n2. ",
"Results and Discussion {#sec2-marinedrugs-17-00149}\n=========================\n\n2.1. ",
"Bioactivity-Guided Isolation and Dereplication of the Active Antiviral Fraction {#sec2dot1-marinedrugs-17-00149}\n------------------------------------------------------------------------------------\n\n### 2.1.1. ",
"Bioactivity-Guided Fractionation Based on Antiviral Activity Against Human Influenza H1N1 A/PR/8/34 Virus {#sec2dot1dot1-marinedrugs-17-00149}\n\nThe 80% MeOH extract of *E. cava*, which showed antiviral activity at 10 µg/mL in a cytopathic effect (CPE) assay when compared to ribavirin (10 µM) as a positive control ([Figure 1](#marinedrugs-17-00149-f001){ref-type=\"fig\"}A), was divided into five fractions on a Diaion HP-20 column, with a gradient of MeOH and H~2~O (0/100→100/0, *v*/*v*), and finally acetone. ",
"The antiviral activities of the five fractions indicated that the sub-fraction eluted with 70% MeOH (EC70) had the strongest antiviral activity against H1N1-infected cells at three different concentrations (5, 10, and 20 µg/mL, [Figure 1](#marinedrugs-17-00149-f001){ref-type=\"fig\"}B). ",
"Thus, the EC70 fraction was chosen for further bio-guided isolation and dereplication using an HPLC-qTOFMS to identify the predicted bioactive compounds ([Figure 2](#marinedrugs-17-00149-f002){ref-type=\"fig\"}). ",
"Potential components against H1N1 and H9N2 viruses were further tested against viral protein synthesis of the H1N1 A/PR/8/34 virus ([Figure 3](#marinedrugs-17-00149-f003){ref-type=\"fig\"}).",
"\n\n### 2.1.2. ",
"Dereplication and Isolation of the Phlorotannins from the EC70 Fraction Using HPLC-qTOFMS and RMD {#sec2dot1dot2-marinedrugs-17-00149}\n\nThe dereplication of the secondary metabolites from *E. cava* was accomplished by HPLC-qTOFMS analysis of the active fraction (EC70). ",
"The HPLC-qTOFMS data were used for database construction based on the chromatographic retention times, full-scan (high-resolution) mass spectra, and MS/MS spectra in negative electrospray ionization (ESI) mode. ",
"The secondary metabolites in the EC70 fraction were identified by comparison with compounds that were previously reported in the *Ecklonia* genus (12 species listed in [Table S1, Supporting Information](#app1-marinedrugs-17-00149){ref-type=\"app\"}) in online (Scifinder) and in-house databases that are based on exact mass and RMD using MassHunter quantitative B4.00 software. ",
"The identified compounds are shown as the base peaks of the MS and MS/MS chromatograms in [Figure 4](#marinedrugs-17-00149-f004){ref-type=\"fig\"}B--E. The MS^1^ and MS^2^ data of all the peaks that were detected in the spectra are listed in [Table 1](#marinedrugs-17-00149-t001){ref-type=\"table\"}. ",
"The RMD value of each peak was used to determine its chemical skeleton. ",
"The structures of the components, which were identified by the comparison of the MS/MS fragmentations of the peaks in [Table 1](#marinedrugs-17-00149-t001){ref-type=\"table\"} to those in the in-house library, are shown in [Figure 2](#marinedrugs-17-00149-f002){ref-type=\"fig\"}.",
"\n\nThe components on the EC70 fraction could be classified as phlorotannins, fatty acids, and others compounds with different ranges of RMD values. ",
"The RMD values of the detected phlorotannins were smaller than those of the other compounds, which are only approximately 10 to 200 ppm due to the nature of the structure of phlorotannins ([Figure S15, Supporting Information](#app1-marinedrugs-17-00149){ref-type=\"app\"}). ",
"Positive absolute mass defects are usually observed in compounds that contain a large number of hydrogen atoms (mass defect +7.83 mDa), whereas the lower values are observed in compounds with large numbers of oxygen (mass defect −5.09 mDa) and nitrogen atoms (mass defect +3.07 mDa) \\[[@B23-marinedrugs-17-00149]\\]. ",
"Fatty acids contain many hydrogens and they have large RMD values (as suggested by compounds **21**, **22**, **24**, and **26**--**29**, [Table 1](#marinedrugs-17-00149-t001){ref-type=\"table\"} and [Figure 2](#marinedrugs-17-00149-f002){ref-type=\"fig\"}), but oxygen is a major elementary building block of phlorotannins, which reduces the RMD values of this group, particularly in this study, to less than 200 ppm (as demonstrated by compounds **6**--**18**, [Table 1](#marinedrugs-17-00149-t001){ref-type=\"table\"}). ",
"These features are very helpful for further studying the genus *Ecklonia,* which contains phlorotannins as major components. ",
"As the first step of screening by HPLC-qTOFMS, the calculation of RMD values for all detected peaks facilitates the identification of phlorotannins and allows researchers to dereplicate the reported compounds, especially in this genus. ",
"The RMD values in the list of unidentified peaks in [Table 1](#marinedrugs-17-00149-t001){ref-type=\"table\"} are also useful for estimating the types of structures that are associated with detected peaks.",
"\n\nFurthermore, polyphenols have lower hydrogen contents and higher oxygen contents when compared to other types of compounds, resulting in lowered RMD values, which is consistent with what is seen in phlorotannins. ",
"Thus, in further studies, classification that is based on the RMD value is suitable for other types of polyphenolic compounds and it can be broadly applied in the screening of natural resources. ",
"In particular, for most species of brown algae, phlorotannin-type compounds can easily be classified because they are the main components of this species.",
"\n\nPhlorotannins, which are composed of phloroglucinol (1,3,5-trihydroxybenzene) units \\[[@B27-marinedrugs-17-00149],[@B28-marinedrugs-17-00149]\\], are well-known as major components of the genus *Ecklonia* \\[[@B9-marinedrugs-17-00149]\\]. ",
"Overall, phlorotannins are divided into four classes that are based on the type of linkage that connects the phloroglucinol units, including ether-bound phlorotannins (fuhalols and phlorethols), phenyl-bound phlorotannins (fucols), ether and phenyl-bound phlorotannins (fucophlorethols), and dibenzo-dioxin-bound fucophlorethols (eckols and carmalols) \\[[@B27-marinedrugs-17-00149],[@B28-marinedrugs-17-00149]\\]. ",
"Monomers in each class can be linked at various positions; thus, it is possible to have many structural isomers with the same molecular weight \\[[@B27-marinedrugs-17-00149],[@B28-marinedrugs-17-00149]\\]. ",
"The fragmentation patterns that were observed for these peaks are therefore key to structural identification, as they indicate different losses of phloroglucinol monomers and hydroxyl groups \\[[@B27-marinedrugs-17-00149]\\]. ",
"In most previous studies, it has been necessary to isolate the compounds and use a combination of MS and NMR spectroscopy to elucidate the exact structures of phlorotannins \\[[@B27-marinedrugs-17-00149]\\]. ",
"Recently, an attempt was made to classify the types of phlorotannins in *Sargassum fursiforme* without isolation using ultrahigh-performance liquid chromatography triple quadrupole tandem mass spectrometry (UHPLC-QqQ-MS) for the first time. ",
"In this study, we proposed an efficient method to dereplicate the various phlorotannins derivatives, which are major constituents in seaweeds, based on preliminary HPLC-qTOFMS accompanied by RMD analysis. ",
"Moreover, the hypothesis of dereplication was further validated by the isolation and structural elucidation of phlorotannins using NMR and HPLC-qTOFMS. ",
"The MS/MS data of the peaks that were detected in the EC70 fraction and the anticipated components are listed in [Table 1](#marinedrugs-17-00149-t001){ref-type=\"table\"}. ",
"As shown in [Figure 4](#marinedrugs-17-00149-f004){ref-type=\"fig\"}C and [Table 1](#marinedrugs-17-00149-t001){ref-type=\"table\"}, forty-one peaks were observed in the HPLC-qTOFMS spectroscopic data of the active fraction, and compounds **6**--**18** ([Table 1](#marinedrugs-17-00149-t001){ref-type=\"table\"}) were identified as phlorotannins based on a comparison of their RMD values, molecular weights, and MS/MS fragments to the literature data. ",
"According to their MS/MS data, thirteen compounds were identified as eckol-type phlorotannins, which contain at least one 1,4-dibenzodioxin fragment in their structures and have been mostly found in *Ecklonia* and some other genus of seaweeds \\[[@B27-marinedrugs-17-00149],[@B28-marinedrugs-17-00149]\\]. ",
"The fragment peaks that were observed in the MS/MS patterns of these compounds revealed the losses of phloroglucinol (126 amu), pentahydroxyl dibenzodioxin (263 amu) and eckol (371 amu) based on the dominant product ions at *m/z* 229 amu \\[371 (eckol) −126 (phloroglucinol) −16 (oxygen atom) amu\\] and 261 amu \\[263 (pentahydroxyl dibenzodioxin) −2H\\]. ",
"For example, bieckol (compound **15**, *m/z* 741.0737, [Table 1](#marinedrugs-17-00149-t001){ref-type=\"table\"}) showed product ions at *m/z* 615, 479, 371, and 260 from losses of one phloroglucinol (−126 amu), two phloroglucinols and a water (−249 −18 amu), eckol (−371 amu), and eckol with a phloroglucinol being followed by the attachment of an oxygen atom (−371 --126 +16 amu).",
"\n\nAccording to dereplication results, ten known phlorotannins (**6**, **7**, **10**--**16**, and **18**) were directly isolated from the EC70 fraction to validate the accuracy of the identification. ",
"These ten compounds were measured HPLC-qTOFMS in negative ion mode at a collision energy of 50 eV to further confirm their retention times ([Figure S16, Supporting Information](#app1-marinedrugs-17-00149){ref-type=\"app\"}). ",
"The fragmentation patterns of the isolated phlorotannins are presented in [Figure S17 (Supporting Information)](#app1-marinedrugs-17-00149){ref-type=\"app\"}. ",
"The results revealed that HPLC-qTOFMS was a powerful tool for identifying the structure of phlorotannins, especially in the cases of isomers, as it can provide sufficient data for the elucidation of the chemical structures. ",
"As an example, the MS/MS fragmentation pattern of compound **18** (*m/z* 974.1038) is presented in detail. ",
"As identified in [Table 1](#marinedrugs-17-00149-t001){ref-type=\"table\"}, compound **18** was established as compound 974-A due to its low RMD value (107 ppm) and the characteristic fragments that were observed at *m/z* 973, 707, 353, and 229 \\[[@B29-marinedrugs-17-00149]\\]. ",
"After isolation, the exact structure of **18** was further confirmed by NMR spectroscopy in conjunction with MS/MS fragmentation ([Figure S17, Supporting Information](#app1-marinedrugs-17-00149){ref-type=\"app\"}). ",
"The product ions of **18** are shown in [Figure S17 (Supporting Information)](#app1-marinedrugs-17-00149){ref-type=\"app\"} and they are due to the losses of bifuhalol (--266 amu), three phlorotannins and one water (−375 −18 amu), and four phlorotannin units and one water (−448 −18 amu). ",
"Similarly, although compounds **10**, **11**, and **15** showed the same molecular ions (\\[M − H\\]^−^ of 741.0647, 741.0723, and 741.0737, respectively) ([Table 1](#marinedrugs-17-00149-t001){ref-type=\"table\"}), they could be distinguished by their NMR data and different fragment ions in their MS/MS patterns ([Figure S17, Supporting Information](#app1-marinedrugs-17-00149){ref-type=\"app\"}). ",
"In particular, compound **10** showed fragments at *m/z* 619.0680, 495.0568, and 250.0477 from the losses of phloroglucinol (126 amu) and two equivalents of phloroglucinol (250 amu). ",
"Compound **11** generated product ion peaks at *m/z* 565.3355, 437.0064, 369.0253, and 230.9843 from the losses of phloroglucinol and three waters (176 amu) and a dioxinodehydroeckol (369 amu). **",
"15** showed product ions at *m/z* 477.0398, 369.0198, 351.0087, and 125.0224, due to the losses of two molecules of phloroglucinol and water (264 amu) and three phloroglucinol units (372 amu).",
"\n\n### 2.1.3. ",
"Antiviral Activities of the Major Phlorotannins in the EC70 Active Fraction against H1N1 and H9N2 {#sec2dot1dot3-marinedrugs-17-00149}\n\nIn this study, seven major phlorotannins that were isolated from the EC70 fraction using bioactivity-guided isolation were tested for their antiviral activities against two influenza A viral strains (H1N1 A/PR/8/34 and H9N2 virus strains) ([Figure 1](#marinedrugs-17-00149-f001){ref-type=\"fig\"}C,D). ",
"The results indicated that six compounds (**6** and **10**--**14**) had moderate to strong antiviral activities against both viral strains at a concentration of 20 µM. Compounds **11**--**14**, which displayed potent antiviral effects, were further tested against viral protein synthesis of the H1N1 A/PR/8/34 virus and compared to ribavirin as a positive control. ",
"The results, as shown in [Figure 3](#marinedrugs-17-00149-f003){ref-type=\"fig\"}A and [Table S2 (Supporting Information)](#app1-marinedrugs-17-00149){ref-type=\"app\"}, suggested that compound **12** was the most active compound with an EC~50~ of 13.48 ± 1.93 μM. Thus, the dose-dependent inhibitory effects of compound **12** on viral protein synthesis were evaluated at four different concentrations 5, 10, 20, and 40 μM in Madin--Darby canine kidney (MDCK) cells. ",
"As shown in [Figure 3](#marinedrugs-17-00149-f003){ref-type=\"fig\"}B, it is clear that, at higher concentrations, **12** more effectively inhibited protein expression in viral-infected cells. ",
"Compound **12** decreased the expression of neuraminidase and hemagglutinin at 10 μM, and the strongest inhibition capacity was observed at 40 µM. The fluorescence images that are shown in [Figure 3](#marinedrugs-17-00149-f003){ref-type=\"fig\"}C also explain the inhibitory effect of compound **12** on neuraminidase protein expression in H1N1 infected MDCK cells. ",
"The results suggested that compound **12** showed strong antiviral activity through inhibiting the expression of surface glycoproteins, hemagglutinin, and neuraminidase.",
"\n\n2.2. ",
"Identification of Two New Phlorotannins from the EC30 Fraction of E. cava using Dereplication and RMD Rules {#sec2dot2-marinedrugs-17-00149}\n----------------------------------------------------------------------------------------------------------------\n\nThe results from the dereplication of the EC70 fraction suggested a quick method to identify phlorotannins. ",
"Hence, we attempted to isolate the new phlorotannins from the other fractions of *E. cava* based on their MS/MS fragmentation patterns and RMD values. ",
"The HPLC-qTOFMS data from fraction EC30 of *E. cava* was exported and the RMD values of the detected peaks were calculated. ",
"Compounds **1** (*m/z* 743.0881, [Table 1](#marinedrugs-17-00149-t001){ref-type=\"table\"}) and **2** (*m/z* 1113.1146, [Table 1](#marinedrugs-17-00149-t001){ref-type=\"table\"}) showed RMD values that were between 0 and 200 ppm, and their fragments, which were not presented in the in-house database or online database of the *Ecklonia* genus, suggested that these compounds might be new phlorotannins ([Figure 4](#marinedrugs-17-00149-f004){ref-type=\"fig\"}A). ",
"Thus, the two compounds were isolated to confirm their chemical structures through NMR spectroscopy along with molecular modelling and MS/MS fragmentation analysis.",
"\n\nCompound **1** was obtained as a brown powder and its molecular formula was determined to be C~36~H~24~O~18~ from its deprotonated ion peak at *m/z* 743.0895 (calcd. ",
"for \\[M − H\\]^−^, 743.0890, [Figure S1, Supporting Information](#app1-marinedrugs-17-00149){ref-type=\"app\"}). ",
"The chemical shifts observed in the ^1^H and ^13^C NMR spectra ([Figures S3, and 4, Supporting Information](#app1-marinedrugs-17-00149){ref-type=\"app\"}), proton resonances in the downfield region of the aromatic chemical shift range, suggested a polyphenolic structure. ",
"In the ^1^H NMR spectrum, eleven aromatic protons were observed, including one proton singlet at δ~H~ 6.12 (H-3), one 2H overlapped singlet at δ~H~ 5.86 (H-3″″, 5″″), and four sets of *meta*-coupled doublets \\[δ~H~ 6.12 (overlap, H-5″)/5.70 (d, 1.5, H-3″), 6.09 (br s, H-6′)/5.99 (d, 1.5, H-2′), 5.97 (d, 2.7, H-8)/5.81 (d, 2.7, H-6), and 589 (d, 2.7, H-5‴)/5.54 (d, 2.7, H-3‴)\\]. ",
"The ^13^C NMR signals corresponded to thirteen unsubstituted (δ~C~ 92.7--100.7 ppm) and twenty-three oxygenated aromatic carbons (δ~C~ 122.1--158.1 ppm), which were assigned based on their HSQC and HMBC correlations ([Figures S5 and S6, respectively, Supporting Information](#app1-marinedrugs-17-00149){ref-type=\"app\"}). ",
"These data suggested that the compound contained six phloroglucinol units. ",
"The coupling constants of the proton signals and HMBC data further confirmed the pattern of the substituents on **1** ([Figure S20A, Supporting Information](#app1-marinedrugs-17-00149){ref-type=\"app\"}). ",
"The signal at δ~H~ 6.12 (1H, s) and the *meta*-coupled doublets at δ~H~ 5.89 (d, 2.7) and 5.81 (d, 2.7) were similar to those of eckol \\[[@B30-marinedrugs-17-00149]\\], and they were thus assigned to H-3 and H-8/H-6 of rings A and B, respectively. ",
"Similarly, the structure of **1** was presumed to include the C, D, E, and F rings of fucodiphloroethol G by comparison with the reported NMR data \\[[@B31-marinedrugs-17-00149]\\]. ",
"The two carbon signals at δ~C~ 100.7 and 101.4 ppm also indicated that the structure of **1** contained one C−C bond similar to that of fucodiphloroethol G \\[[@B31-marinedrugs-17-00149]\\]. ",
"However, the asymmetric structure of the C ring revealed that fucodiphloroethol and eckol moieties of **1** were linked through the C ring. ",
"The ROESY correlation of H-3 (A ring) with 5′-hydroxyl (C ring) ([Figure S7, Supporting Information](#app1-marinedrugs-17-00149){ref-type=\"app\"}) suggested a phenyl linkage connecting the C and A rings. ",
"The long-range couplings between the proton of rings A and C, as well as rings B and E, were explained by their positions derived from three-dimensional structure optimization using molecular modelling ([Figure S20B, Supporting Information](#app1-marinedrugs-17-00149){ref-type=\"app\"}). ",
"A comprehensive explanation of the structure was obtained from the MS/MS data. ",
"As shown in [Figure S17 (Supporting Information)](#app1-marinedrugs-17-00149){ref-type=\"app\"}, the fragment ion corresponding to C~24~H~15~O~11~ (*m/z* 479.0608, calcd 479.0614, Δ −0.6 mmu) was the main fragment of **1**, and the other detected fragments were explained by the losses of phloroglucinol units (−126 amu) or pentahydroxyl dibenzodioxin (263 amu). ",
"In particular, the fragments of **1** at *m/z* 583.0716, 479.0608, 353.0284, and 265.0342 amu were from the losses of one phloroglucinol and two water molecules (−126 −34 amu), two phloroglucinol units and one oxygen atom (−248 −16 amu), three phloroglucinol and one water (−372 --18 amu), and pentahydroxyl dibenzodioxin and two protons (−263 −2 amu). ",
"Therefore, the chemical structure of **1** was determined to be dibenzodioxin-fucodiphloroethol (DFD).",
"\n\nCompound **2** was obtained as a brown powder and the molecular formula of **2** was established to be C~54~H~34~O~27~ on the basis of its molecular ion in the negative mode (HPLC-qTOFMS, *m/z* 1113.1215, calcd. ",
"for \\[M − H\\]^−^, 1113.1215) ([Figure S8, Supporting Information](#app1-marinedrugs-17-00149){ref-type=\"app\"}). ",
"The ^1^H NMR spectrum of **2** ([Figure S10, Supporting Information](#app1-marinedrugs-17-00149){ref-type=\"app\"}) showed a total of sixteen proton signals, including three proton singlets at δ~H~ 6.21 (1H, s, H-5″″″), 6.14 (1H, s, H-4″″‴), and 5.92 (1H, s, H-3); two sets of *meta*-coupled doublets at δ~H~ 6.01 (1H, d, 2.2 Hz, H-6), 5.88 (1H, d, 2.2 Hz, H-8), 5.89 (1H, d, 2.4 Hz, H-5‴), and 5.55 (1H, d, 2.4 Hz, H-3‴); two sets of *meta*-coupled 2H signals at δ~H~ 5.87 (2H, s, H-3″, 5″), 5.74 (2H, d, 1.8 Hz, H-2′, 6′), and 5.81 (1H, br t, H-4′); and, two sets of *meta*-coupled singlets at δ~H~ 6.14 (1H, br s, H-5″″), 5.71 (1H, br s, H-3″″), 6.11 (1H, br s, H-5″‴), and 6.00 (1H, br s, H-3″‴). ",
"The ^13^C NMR spectrum of **2** ([Figure S11, Supporting Information](#app1-marinedrugs-17-00149){ref-type=\"app\"}) showed 54 signals in the chemical shift range of aromatic carbons. ",
"The thirteen protonated carbon signals from δ~C~ 92.7 to 98.7 ppm, along with thirty-six oxygenated aromatic carbon signals that were located in the range of 121.4--163.5 ppm, suggested the presence of nine aromatic rings in the structure of **2**. ",
"All of the carbon signals in ^13^C NMR spectrum of **2** were assigned based on their HSQC and HMBC correlations ([Table S3 and Figures S12 and S13, Supporting Information](#app1-marinedrugs-17-00149){ref-type=\"app\"}). ",
"When compared with the reported phlorotannins, the chemical shifts of the atoms in rings A, B, C, and D of **2** were similar to those belonging to 7-phloroeckol \\[[@B32-marinedrugs-17-00149]\\]. ",
"Similarly, the chemical shifts of the atoms in rings D, E, F, and G were assigned based on the structure of fucodiphloroethol G \\[[@B31-marinedrugs-17-00149]\\]. ",
"The C−C bond between rings F and G of **2** was confirmed from the chemical shifts at δ~C~ 100.7 and 101.5 ppm. ",
"In addition, the remaining two aromatic rings of **2** were suggested to be rings H and I based on the MS/MS fragmentation analysis of **2**. ",
"The fragment at 265 amu was suggested by the vicinal trihydroxylated structure of compound **2** ([Figure S17, Supporting Information](#app1-marinedrugs-17-00149){ref-type=\"app\"}), which was characteristic of a bifuhalol unit that contained an extra hydroxyl group on the terminal phlorotannin unit \\[[@B27-marinedrugs-17-00149]\\]. ",
"The connectivity between all of the fragments was further determined by the ROESY spectrum ([Figure S14, Supporting Information](#app1-marinedrugs-17-00149){ref-type=\"app\"}). ",
"The correlations of the signals corresponding to H-2′/6′ in ring A with H-3 (B ring) and H-6 (C ring) and between H-6 (C ring) with H-3 (D ring) confirmed the connectivity of these rings, as shown in [Figure S20 (Supporting Information)](#app1-marinedrugs-17-00149){ref-type=\"app\"}. ",
"The 7-phloroeckol moiety was connected to the 1‴ position of the ring E based on the ROESY correlation between the H-3″ (D ring) and H-6‴ (E ring). ",
"Similar to compound **1**, the long-range correlations of the protons on rings A and D, as well as on rings B and G of **2**, were further supported by the optimized three-dimensional structure obtained using molecular modelling ([Figure S20B, Supporting Information](#app1-marinedrugs-17-00149){ref-type=\"app\"}). ",
"The fragment information from HRMS/MS data of **2,** as described in [Figure S17 (Supporting Information)](#app1-marinedrugs-17-00149){ref-type=\"app\"}, also supported the chemical structure of compound **2**. ",
"The fragments that were observed in [Figure S17 (Supporting Information)](#app1-marinedrugs-17-00149){ref-type=\"app\"} at *m/z* 989.0983, 879.0299, 556.0534, and 265.0334 amu were explained by the losses of one phloroglucinol unit (−126 amu); two phloroglucinol units and the addition of one water (−252 and +18 amu); one eckol, one bifuhalol, the addition of one acetic acid, and one water (−372 −263 +60 +18 amu); and, a bifuhalol fragment at 265.0334 amu. ",
"Finally, the exact structure of **2** was elucidated as dibenzodioxin-fucodiphloroeckol (DFE).",
"\n\n2.3. ",
"Discussion of the Potential Applications of the Developed Dereplication Strategy and Phlorotannins {#sec2dot3-marinedrugs-17-00149}\n-------------------------------------------------------------------------------------------------------\n\nIn this paper, the developed dereplication strategy using RMD values is based on the general dereplication strategy that determines the similarities between the MS/MS fragmentation patterns of standard compounds and those of the unknown compounds. ",
"However, unlike the general dereplication method, RMD can be used to group compounds of the same type to show the overall phytochemical trends by the types of secondary metabolites. ",
"The extracts of *E. cava* or phlorotannins (dieckol, phloroglucinol, eckol, phlorofucofuroeckol, and 7-phloroeckol, etc.) ",
"have been reported to have antiviral activities, such as PEDV \\[[@B9-marinedrugs-17-00149]\\], viral hemorrhagic septicemia virus (VHSV) \\[[@B33-marinedrugs-17-00149]\\], human papilloma virus (HPV) \\[[@B34-marinedrugs-17-00149]\\], and murine norovirus (MNV) \\[[@B35-marinedrugs-17-00149]\\]. ",
"However, in this study, a method of producing a bioactive fraction was developed, and this fraction could be used to obtain antiviral materials from a total extract. ",
"Additionally, seven lead compounds were identified and purified from the bioactive fraction. ",
"Therefore, the fraction of the *E. cava* extract and the isolated phlorotannins have been shown to be potentially industrially applicable in the prevention or treatment of influenza A viruses.",
"\n\n3. ",
"Conclusions {#sec3-marinedrugs-17-00149}\n==============\n\nThe present study discussed using MS/MS fragmentation analysis coupled with RMD filtering as a dereplication method to identify phlorotannins, which are bioactive substances in the *Ecknolia* genus, especially in *Ecknolia cava*. ",
"To the best of our knowledge, this is the first attempt to apply and post-evaluate the accuracy of the RMD values in conjunction with MS/MS analysis for the identification of phlorotannins. ",
"The results of the dereplication study provide a quick initial screening for the phlorotannin motif, as these compounds show RMD values of less than 200 ppm, typically with fragments from losses of phloroglucinol units. ",
"In addition, different ranges of RMD values suggest the presence of different types of structures that are present in the compound. ",
"MS/MS was not only useful for dereplication but it also provided strong evidence to confirm the structures of phlorotannins by their fragments. ",
"Based on this dereplication method, two new compounds were identified and further elucidated by spectroscopy. ",
"In addition, this study was conducted to identify the antiviral lead compounds from *E. cava* using bio-guided isolation. ",
"Our results suggested that phlorofucofuroeckol A (**12**) from *E. cava* plays a key role in the antiviral activities of this seaweed against H1N1 and H9N2 virus. ",
"The strong inhibitory effects of this compound against neuraminidase and hemagglutinin suggested that it could be a potential agent for the further development of antiviral drugs.",
"\n\n4. ",
"Materials and Methods {#sec4-marinedrugs-17-00149}\n========================\n\n4.1. ",
"General Experimental Procedures {#sec4dot1-marinedrugs-17-00149}\n------------------------------------\n\nOptical rotations were determined on a JASCO P-2000 polarimeter (JASCO International Co. Ltd., Tokyo, Japan). ",
"The IR spectra were recorded on a Nicolet 6700 FT-IR spectrometer (Thermo Electron Corp., Waltham, MA, USA). ",
"NMR data were measured in DMSO-*d*~6~ and recorded on 300, 800, and 850 MHz spectrometers at the College of Pharmacy, Seoul National University, Korea. ",
"ESI-MS data were recorded on an Agilent 1100 series LC/MSD TRAP (Agilent Technologies, Waldbronn, Germany). ",
"The active fractions were analysed by TLC (thin-layer chromatography) on silica gel 60 F254 and RP-18 F254 plates from Merck (Darmstadt, Germany). ",
"Spraying with a vanillin reagent that contained 0.5 g of vanillin, 80 mL of sulfuric acid, and 20 mL of ethanol developed the plates, and the compounds on the TLC plates were detected at 254 and 365 nm. ",
"Column chromatography separations were carried out using various resins, including Diaion HP-20 (Mitsubishi Chemical Co. Tokyo, Japan), Sephadex LH-20 (Sigma-Aldrich Corp, St. Louis, Missouri, USA), silica gel (Merck, 40--63 µm particle size), and C~18~-RP silica gel (Merck, 40--63 μm particle size). ",
"Preparative HPLC separations were performed by using a Gilson system with an Optima Pak C~18~ column (10 mm × 250 mm, 10 µm in particle size, RS Tech, Seoul, Korea) and a UV detector at wavelengths of 205 and 254 nm. ",
"All of the solvents that were used for extraction and isolation were of analytical grade. ",
"The most stable configuration of compounds **1** and **2** ([Figure S20, Supporting Information](#app1-marinedrugs-17-00149){ref-type=\"app\"}) were calculated by CONFLEX 8 (Conflex Corp., Tokyo, Japan) using molecular mechanics force-field (MMFF94s) calculations with a search limit of 1.0 kcal/mol.",
"\n\n4.2. ",
"Plant Material {#sec4dot2-marinedrugs-17-00149}\n-------------------\n\n*E. cava* was collected from Cheongsando Island, Republic of Korea in July 2016. ",
"Prof. T. O. Cho botanically identified the plant sample. ",
"A voucher specimen (TCMBRB0019/TC9484) was deposited at the Algae Systematics laboratory of Chosun University, College of Natural Sciences, Gwang-ju, Republic of Korea.",
"\n\n4.3. ",
"Extraction and Isolation {#sec4dot3-marinedrugs-17-00149}\n-----------------------------\n\nDried powder of *E. cava* (100 g) was extracted with 80% MeOH (5 L) at room temperature under ultra-sonication for two days. ",
"After filtration, the combined MeOH solution was concentrated under reduced pressure to yield dry extract (20.4 g). ",
"The crude extract was suspended in distilled water (2 L) and then fractionated using Diaion HP-20. ",
"Four litres of water was used to elute the salts and then two litres each of 30% MeOH, 70% MeOH, 100% MeOH, and 100% acetone were used as the elution systems to obtain five fractions. ",
"The fraction eluted with 30% MeOH was chromatographed on a reversed-phase silica gel column with a gradient of MeOH/H~2~O from 30% to 100% to yield five subfractions (F1--F5) ([Scheme S1, Supporting Information](#app1-marinedrugs-17-00149){ref-type=\"app\"}). ",
"Sub-fraction F2 was subjected to a Sephadex LH-20 column that was eluted with 100% MeOH to afford four fractions (F2.1--F2.4). ",
"Fraction F2.3 was further purified on a Sephadex column with 100% MeOH to give three subfractions (F2.3.1--3). ",
"Subfraction F2.3.2 was further purified by semi-preparative HPLC \\[Optimapack C~18~ column (10 mm × 250 mm, 10 µm particle size, RS Tech, Seoul, Korea); mobile phase MeCN in H~2~O containing 0.1% HCO~2~H (0--40 min: 35 to 100% MeCN, 41--51 min: 100% MeCN); and, flow rate: 2 mL/min\\] to yield compounds **1** (6.0 mg) and **2** (5.0 mg). ",
"The 70% MeOH fraction was separated by reversed-phase chromatography (40--63 µm particle size) with a stepwise elution gradient of MeOH/H~2~O (2:3--1:0) to afford four subfractions (F70.1--F70.4). ",
"The fraction F70.1 was subjected to HPLC \\[Optimapack C~18~ column (10 mm × 250 mm, 10 µm particle size, RS Tech, Seoul, Korea); mobile phase MeCN in H~2~O containing 0.1% HCO~2~H (0--65 min: 20% MeCN, 65 min: 100% MeCN); flow rate: 2 mL/min\\] to afford compounds **11** (dieckol, 15.0 mg), **13** (dibenzo\\[1,4\\]dioxine-2,4,7,9-tetraol, 3.0 mg), **6** (eckol, 2.0 mg), and **10** (6,6′-bieckol, 2.0 mg). ",
"Subsequently, fraction F70.2 was separated by HPLC \\[Optimapack C~18~ column (10 mm × 250 mm, 10 µm particle size, RS Tech, Seoul, Korea); mobile phase MeCN in H~2~O containing 0.1% HCO~2~H (0--65 min: 20% MeCN, 65 min: 100% MeCN); flow rate: 2 mL/min\\] to give compounds **12** (phlorofucofuroeckol A, 15.0 mg) and **14** (dioxinodehydroeckol, 4.0 mg). ",
"Fraction F70.3 was further purified by HPLC (Optimapack C~18~ column (10 mm × 250 mm, 10 µm particle size, RS Tech, Seoul, Korea); mobile phase MeCN in H~2~O containing 0.1% HCO~2~H (0--60 min: 30% MeCN, 65 min: 100% MeCN); flow rate: 2 mL/min) to yield compound **16** (fucofuroeckol A, 4.0 mg). ",
"All of the isolated materials and related information were kept in the Korea Bioactive Natural Material Bank (KBNMB).",
"\n\n### 4.3.1. ",
"Dibenzodioxin-fucodiphloroethol (DFD) (**1**) {#sec4dot3dot1-marinedrugs-17-00149}\n\nBrown powder; \\[*α*\\]${}_{D}^{20}$ +1.5 (*c* 0.1, MeOH); UV(MeOH) λ~max~ (log ε) 230 (2.15); IR *ν*~max~ 3863, 3840, 3734, 3647, 3272, 2675, 2348, 1748, 1620, 1540, 1508, 1487, 1396, 1269, 1198, 1150, 1090, 1039, 1024 cm^−1^; ^1^H and ^13^C NMR data (800/200 MHz; DMSO-*d*~6~), see [Table S3](#app1-marinedrugs-17-00149){ref-type=\"app\"}; HRFABMS *m/z* 743. ",
"0895 (calcd. ",
"for \\[M − H\\]^−^, 743.0890).",
"\n\n### 4.3.2. ",
"Dibenzodioxin-fucodiphloroeckol (DFE) (**2**) {#sec4dot3dot2-marinedrugs-17-00149}\n\nBrown powder; \\[*α*\\]${}_{D}^{20}$ −22.7 (*c* 0.1, MeOH); UV(MeOH) λ~max~ (log ε) 230 (2.15); IR *ν*~max~ 3840, 3223, 2348, 1748, 1620, 1508, 1474, 1396, 1259, 1088, 1039, 1023, 997, 827 cm^−1^; ^1^H and ^13^C NMR data (850/212.5 MHz; DMSO-*d*~6~), see [Table S3](#app1-marinedrugs-17-00149){ref-type=\"app\"}; HRFABMS *m/z* 1113.1215 (calcd. ",
"for \\[M − H\\]^−^, 1113.1215).",
"\n\n4.4. ",
"HPLC-qTOFMS Measurement {#sec4dot4-marinedrugs-17-00149}\n----------------------------\n\nHPLC-qTOFMS was performed on an Agilent 6500 series instrument (Agilent technologies, USA) with a dual ESI interface at the College of Pharmacy, Seoul National University, Korea. ",
"A YMC-Triart C~18~ column (150 mm × 3.0 mm i.d., ",
"5 μm) was used for separation. ",
"The elution gradient consisted of H~2~O (A) and MeCN (B) (both buffered with 0.01% formic acid) increased from 10% B to 60% B (for fraction EC30) and 100% B (for fraction EC70) in 40 min (0.3 mL/min), where it was held in 12 min (1 mL/min), returned to 10% B in 0.1 min, and then maintained for 5 min (0.3 mL/min). ",
"Nitrogen was used as the drying gas and collision gas in the ESI source. ",
"The electrospray ion source parameters were as follows: drying gas flow rate, 10 L/min; heated capillary temperature, 350 °C; sheath gas temperature of 350 °C and flow of 12 L/min; nebulizer pressure, 30 psi; VCap, fragmentor, skimmer, and octopole RF peak voltages that were set at 4000, 180, 60, and 750 V, respectively. ",
"The detection was carried out in positive and negative electrospray ionization modes, and the spectra were recorded by MS scanning in the range of *m/z* 100--1000. ",
"The MS/MS analyses were carried out by targeted fragmentation and the collision energy was set at 20--80 eV for fractions EC30 and EC70 and at 50 eV for single compounds. ",
"MassHunter software version B.06.01 (Agilent Technology) was used to control the LC--MS/MS system. ",
"Version B.07.00 was used for data acquisition, analysis, and processing, including the prediction of chemical formula and exact mass calculation.",
"\n\n4.5. ",
"Cell Cultures and Viruses {#sec4dot5-marinedrugs-17-00149}\n------------------------------\n\nMDCK cells were provided by American Type Culture Collection (ATCC, Manassas, VA 20108, USA) and cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin. ",
"Influenza A viruses (H1N1 A/PR/8/34 or H9N2 A/chicken/Korea/01210/2001) were obtained from Choong Ang Vaccine Laboratory, Korea, and they were stored at −80 °C.",
"\n\n4.6. ",
"Cytotoxicity Assay {#sec4dot6-marinedrugs-17-00149}\n-----------------------\n\nThe cell viabilities were evaluated by a MTT (3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide) assay. ",
"Briefly, MDCK cells were seeded in 96-well plates at 1 × 10^5^ cells per well and then incubated for 24 h. The cultures were then replaced with DMEM-free serum and treated with the test compounds for 48 h. To avoid solvent toxicity, the final concentration of dimethyl sulfoxide (DMSO) was maintained at 0.05% (*v*/*v*). ",
"Subsequently, 20 μL of a 2 mg/mL MTT solution was added to each well and the plates were incubated for 4 h at 37 °C. ",
"After removing the medium, the formazan crystals were dissolved with 100 μL of DMSO and the absorbance was measured at 550 nm using a microplate reader (VersaMaxTM, Randor, PA, USA). ",
"All of the experiments were performed in triplicate. ",
"Regression analysis was applied to calculate the 50% cytotoxic concentration (CC~50~).",
"\n\n4.7. ",
"Cytopathic Effect (CPE) Assay {#sec4dot7-marinedrugs-17-00149}\n----------------------------------\n\nMDCK cells were seeded onto 96-well plates and incubated for 24 h. After washing twice with phosphate-buffered saline (PBS), the cells were infected with influenza viruses using DMEM that contained 0.15 µg/mL trypsin and 5 µg/mL BSA for 2 h. The cells were then washed with PBS, and new media containing the fractions or test compounds at different concentrations was added. ",
"After incubation for three days at 37 °C under a 5% CO~2~ atmosphere, the medium was replaced with DMEM, 20 µL of 2 mg/mL MTT was added to each well, and the plates were incubated for an additional 4 h. The next steps followed a typical cytotoxicity assay procedure and the 50% effective concentration (EC~50~) was calculated by regression analysis.",
"\n\n4.8. ",
"Western Blot Analysis {#sec4dot8-marinedrugs-17-00149}\n--------------------------\n\nMDCK cells were grown into 6-well plates and infected with H1N1 A/PR/8/34 virus for 2 h. The cells were then washed with PBS and the media was replaced with new media with various concentrations of the test compounds. ",
"After 24 h of incubation, the cells were washed with cold PBS and then lysed with 100 µL of lysis buffer \\[50 mM Tris-HCl (pH 7.6), 120 mM NaCl, 1 mM EDTA, 0.5% NP-40, and 50 mM NaF\\]. ",
"The supernatants were collected, and the protein concentrations were determined using a protein assay kit (Bio Rad Laboratories Inc., USA). ",
"The aliquots of the lysates were boiled for 5 min and loaded onto 10% or 12% SDS-polyacrylamide gels. ",
"The gels were then electrophoresed and electrotransferred to polyvinylidene fluoride membranes (PVDF 0.45 µm, Immobilon-P, USA). ",
"After blocking with a 5% skim milk solution, the membranes were incubated overnight at 4 °C with primary antibodies, namely, neuraminidase (Gene Tex, San Antonio, TX, USA), hemagglutinin (Sigma, St Louis, MO, USA), or mouse monoclonal actin (Abcam, Cambridge, UK). ",
"After washing a few times with PBS, the membranes were incubated with secondary antibodies for 2 h and then detected by a chemiluminescence Western blotting detection kit (Thermo Fisher Scientific., ",
"Rockford, IL, USA) using an Image Quant^TM^ LAS4000 imaging system.",
"\n\n4.9. ",
"Immunofluorescence Assay {#sec4dot9-marinedrugs-17-00149}\n-----------------------------\n\nThe MDCK cells were maintained on sterile glass coverslips and then infected with H1N1 A/PR/8/34 virus for 2 h. After that, the cells were transferred to new media containing the test compounds at various concentrations. ",
"The cultures were incubated at 37 °C under a 5% CO~2~ atmosphere for 24 h. After fixation and permeabilization, the cells were blocked with 1% bovine serum albumin (BSA) solution (Sigma, St. Louis, MO, USA) for 1 h and then incubated overnight with monoclonal neuraminidase antibody (Gene Tex) that was diluted 1:50 in PBS. ",
"The cells were then incubated with the secondary antibody FITC (fluorescence isothiocyanate)-conjugated goat anti-Rb IgG (Abcam, Cambridge, UK) for 1 h, and the nuclei were stained with 500 nM 4′,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific, USA) solution for 5 min at room temperature. ",
"The slides were mounted with mounting medium for fluorescence (Vectashield, Vector Lab, Inc., USA). ",
"The immunofluorescence images were acquired with fluorescence microscopy (Olympus ix70 Fluorescence Microscope, Olympus Corporation, Tokyo, Japan).",
"\n\n4.10. ",
"Statistical Analysis {#sec4dot10-marinedrugs-17-00149}\n--------------------------\n\nThe results are presented as the mean ± SD of three independent experiments. ",
"The significant differences between the groups were calculated by one-way analysis of variance (ANOVA) using Tukey's or Duncan's post hoc tests, which were conducted with SPSS Statistics 23 software (SPSS, Inc., Chicago, IL, USA). ",
"Statistical significance was accepted at \\* *p* \\< 0.05, \\*\\* *p* \\< 0.01, and \\*\\*\\* *p* \\< 0.001. ",
"ImageJ software was applied for Western blot analysis.",
"\n\nThe following are available online at <https://www.mdpi.com/1660-3397/17/3/149/s1>, Figure S1: HRESIMS spectrum of compound **1**; Figure S2: IR spectrum of compound **1**; Figure S3: ^1^H NMR spectrum of compound **1** (800 MHz, DMSO-*d*~6~); Figure S4: ^13^C NMR spectrum of compound **1** (200 MHz, DMSO-*d*~6~); Figure S5: HSQC spectrum of compound **1** (800 MHz, DMSO-*d*~6~); Figure S6: HMBC spectrum of compound **1** (800 MHz, DMSO-*d*~6~); Figure S7: ROESY spectrum of compound **1** (800 MHz, DMSO-*d*~6~); Figure S8: HRESIMS spectrum of compound **2**; Figure S9: IR spectrum of compound **2**; Figure S10: ^1^H NMR spectrum of compound **2** (850 MHz, DMSO-*d*~6~); Figure S11: ^13^C NMR spectrum of compound **2** (212.5 MHz, DMSO-*d*~6~); Figure S12: HSQC spectrum of compound **2** (850 MHz, DMSO-*d*~6~); Figure S13: HMBC spectrum of compound **2** (850 MHz, DMSO-*d*~6~); Figure S14: ROESY spectrum of compound **2** (850 MHz, DMSO-*d*~6~); Figure S15: Relationships between ion masses (*m/z* value) in negative ion mode and RMD values for compounds detected by HPLC-qTOFMS in the EC70 fraction; Figure S16: HPLC-qTOFMS measurement for twelve isolated compounds in negative ion mode at collision energy of 50 eV; Figure S17: MS/MS spectra and fragment ions analysis of isolated compounds. ",
"HPLC-qTOFMS spectroscopic data of these single compounds were measured in negative mode at collision energy of 50 eV; Figure S18: Effects of compound **11**, **12**, **13**, and **14** on the viral protein synthesis at a concentration of 20 µM; original uncropped blots; Figure S19: Inhibitory effects of compound **12** on the viral proteins synthesis in a concentration-dependent manner; original uncropped blots; Figure S20: (A) Key HMBC correlations of compounds **1** and **2**. (",
"B) Key ROESY correlations on 3D structure of compounds **1** and **2;** Figure S21: Physicochemical properties of isolated known compounds from *E. cava*; Table S1: List of species in *Ecklonia* genus from website World Register of Marine Species (<http://www.marinespecies.org>); Table S2: The inhibitory effects of compounds **11**, **12**, **13**, and **14** against the H1N1 A/PR/8/34 virus in a cytopathic effect and cytotoxicity assays; Table S3. ",
"^1^H and ^13^C NMR spectroscopic data of compounds **1** and **2** in DMSO-*d*~6~ (*δ* in ppm); Scheme S1: Extraction and fractionation procedure of *E. cava.*",
"\n\n###### \n\nClick here for additional data file.",
"\n\nH.M.C. and T.P.D. performed phytochemical experiments and analysis experiments. ",
"T.K.Q.H. designed and performed biological experiments. ",
"H.W.K., B.W.L. and H.T.T.P. performed phytochemical experiments. ",
"T.O.C. collected and authenticated the plant. ",
"W.K.O. provided experimental ideas, designed the research and analyzed the data. ",
"W.K.O. contributed to the supervision and discussion and reviewed/edited the manuscript. ",
"All authors reviewed the manuscript.",
"\n\nThis work was supported financially in part by grants from the Marine Biotechnology Program of the Ministry of Oceans and Fisheries (PJT200669) and the Korea Institute of Planning and Evaluation for Technology in Food, Agriculture and Forestry (IPET) through the Animal Disease Management Technology Development Program funded by the Ministry of Agriculture, Food and Rural Affairs (MAFRA) (318031031SB010).",
"\n\nThe authors declare no conflicts of interest.",
"\n\n{#marinedrugs-17-00149-f001}\n\n{#marinedrugs-17-00149-f002}\n\n{#marinedrugs-17-00149-f003}\n\n{#marinedrugs-17-00149-f004}\n\nmarinedrugs-17-00149-t001_Table 1\n\n###### \n\nMS/MS fragmentation of the peaks detected in the total ion chromatograms of the EC30 and EC70 fractions of *E. cava* in negative ionization mode.",
"\n\n No Compound Name RT (min) MS ^1^ MS ^2^ \\[M − H\\]^−^ Chemical Formula Calcd. ",
"Mass Dif. ",
" RMD\n -------- --------------------------------------------------------------- ---------- ------------------------------------ ---------------------------------------- -------------- ------------------ ------------- -------- ------\n **1** Compound **1** 21.793 195, 247, 389, 479, 583, 743 139, 231, 285, 353, 447, 493, 643, 743 743.0881 C~36~H~23~O~18~ 743.0884 −1.73 119\n **2** Compound **2** 25.279 195, 359, 479, 556, 663, 982, 1113 231, 353, 461, 705, 925, 1104, 1113 1113.1146 C~54~H~33~O~27~ 1113.1209 −7.94 103\n **3** Benzo\\[1,2-b:3,4-b′\\]bis\\[1,4\\] benzodioxin-1,3,6,9,11-pentol 24.015 195, 211, 246, 292, 369 193, 230, 267, 285, 310, 369 369.0224 C~18~H~9~O~9~ 369.0247 −4.80 61\n **4** Unknown 2.268 162, 197 163, 821 162.8392 \\- 5154\n **5** Unknown 2.631 122, 139, 168, 195 111, 139, 171 195.9504 \\- 4850\n **6** Eckol 15.543 154, 371 217, 246, 282, 371 371.0446 C~18~H~11~O~9~ 371.0403 6.56 120\n **7** 7-Phloroeckol 15.845 154, 495 263, 297, 387, 488, 495, 616 495.0511 C~24~H~15~O~12~ 495.0564 −7.28 103\n **8** 2-Phloroeckol 16.003 154, 263, 495 201, 229, 283, 346, 495 495.0528 C~24~H~15~O~12~ 495.0564 −6.00 107\n **9** Dibenzo\\[b,e\\]\\[1,4\\]dioxin-1,2,4,7,9-pentol 16.209 137, 155, 263 207, 218, 263 263.0157 C~12~H~7~O~7~ 263.0192 −5.92 60\n **10** 6,6′-Bieckol 18.854 154, 741 229, 261, 371, 479, 585, 666, 741 741.0647 C~36~H~21~O~18~ 741.0728 −9.00 87\n **13** Dibenzo\\[1,4\\]dioxine-2,4,7,9-tetraol 19.274 123, 155, 247 141, 195, 247, 385, 479 247.0243 C~12~H~7~O~6~ 247.0243 0.00 98\n **15** 6,8′-Bieckol 19.569 741 260, 371, 479, 615, 741 741.0737 C~36~H~21~O~18~ 741.0728 3.00 99\n **11** Dieckol 19.917 321, 741 229, 261, 371, 430, 545, 714, 741 741.0723 C~36~H~21~O~18~ 741.0728 −2.24 98\n **14** Dioxinodehydroeckol 20.370 123, 196, 325, 369 123, 161, 173, 199, 261, 369 369.0269 C~18~H~9~O~9~ 369.0247 4.69 73\n **12** Phlorofucofuroeckol A 21.796 155, 601 245, 385, 447, 493, 601 601.0640 C~30~H~17~O~14~ 601.0618 4.69 106\n **17** 2,7″-phloroglucinol 6,6′-bieckol (PHB) 22.018 155, 973 229, 353, 427, 493, 707, 806, 973 973.1153 C~48~H~29~O~23~ 973.1100 7.28 118\n **18** 974-A 22.050 113, 601, 973 229, 353, 393, 605, 707, 805, 941 973.1038 C~48~H~29~O~23~ 973.1100 −7.87 107\n **19** Unknown 22.44 155, 369, 551 223, 304, 551, 583, 710 551.1816 \\- 329\n **16** Fucofuroeckol A 22.897 155, 477, 2551, 352, 477, 545 477.0425 C~24~H~13~O~11~ 477.0457 −5.66 89\n **20** Unknown 23.799 242, 310 201, 271, 348 242.1758 \\- 726\n **21** 6,9,12-Octadecatrienoic acid, (6Z,9Z,12Z) 29.966 277, 527 264, 353, 481, 277.2125 C~18~H~29~O~2~ 277.2168 −6.56 767\n **22** 9,12-Octadecadienoic acid (9Z,12Z) 30.496 279 218, 248, 279, 346, 380 279.2168 C~18~H~31~O~2~ 279.2324 −12.49 776\n **23** Ecklonialactone B (R/S) 32.281 265, 291 201, 291 291.2020 C~18~H~27~O~3~ 291.1960 7.75 694\n **24** Eicosanoic acid 34.206 311 225, 311, 349 311.2848 C~20~H~39~O~2~ 311.2950 −10.10 915\n **25** Ecklonialactone B (S/R) 34.499 291, 555, 623 251, 291, 411,651 291.1938 C~18~H~27~O~3~ 291.1960 −4.96 666\n **26** 11,14,17-Eicosatrienoic acid, (11Z,14Z,17Z)- 34.771 305 211, 284, 305, 248, 583, 804 305.2410 C~20~H~33~O~2~ 305.2481 −8.43 790\n **27** Tricosanoic acid 36.294 353 257, 333, 353, 529 353.3407 C~23~H~45~O~2~ 353.3420 −3.61 964\n **28** Heneicosanoic acid 36.667 325 225, 239, 248, 267, 282, 325 325.3131 C~21~H~41~O~2~ 325.3107 4.90 962\n **29** Unknown 37.806 293, 325 281, 325, 386, 449, 674 325.1812 \\- 557\n **30** Unknown 37.869 239, 293 207, 239, 243, 383 239.0709 \\- 297\n **31** Unknown 38.947 321 248, 321, 399, 572, 815 321.2178 \\- 678\n **32** Docosanoic acid 39.599 339 226, 339, 433, 660, 809 339.3292 C~22~H~43~O~2~ 339.3263 5.39 970\n **33** Unknown 41.028 346 206, 254, 330, 346, 642 346.1092 \\- 316\n **34** Unknown 41.59 346, 485 280, 421, 485 485.2671 \\- 550\n **35** 5,8,11,14,17-Eicosapentaenoic acid, (5Z,8Z,11Z,14Z,17Z) 43.93 301, 369 205, 269, 301, 440 301.2099 C~20~H~29~O~2~ 301.2168 −8.31 697\n **36** Triacontanoic acid 47.116 346, 451, 535, 691, 775 295, 387, 451, 456 451.4499 C~30~H~59~O~2~ 451.4515 −4.00 997\n **37** Dotricontanoic acid 47.575 346, 479, 609, 691, 775 461, 479, 648, 866 479.2903 C~32~H~63~O~2~ 479.4828 −5.00 606\n **38** Unknown 49.963 223, 297, 441, 535, 701, 849 254, 333, 441, 673 441.2074 \\- 470\n **39** Unknown 51.118 149, 223 149, 448 149.0021 \\- 14\n **40** Unknown 53.856 149, 223, 297 149, 221, 350, 630.7708 149.0086 \\- 58\n **41** Unknown 58.796 135 135.9698, 287.5036 135.9751 \\- 7171\n\n[^1]: These authors contributed equally.",
"\n"
] |
{
"pile_set_name": "PubMed Central"
}
|
[
0,
0.005154639175257732,
0.014705882352941176,
0.009302325581395349,
0.01084010840108401,
0.006779661016949152,
0.008368200836820083,
0.01293103448275862,
0.005235602094240838,
0.00819672131147541,
0.006779661016949152,
0.015228426395939087,
0.02631578947368421,
0.008298755186721992,
0.003194888178913738,
0.009216589861751152,
0.010582010582010581,
0.00423728813559322,
0.005025125628140704,
0.005025125628140704,
0.004347826086956522,
0,
0,
0.005952380952380952,
0.005747126436781609,
0,
0,
0,
0,
0.004761904761904762,
0.005870841487279843,
0,
0,
0,
0,
0.007407407407407408,
0.009478672985781991,
0.005319148936170213,
0.006734006734006734,
0,
0,
0,
0,
0.0031645569620253164,
0,
0,
0,
0,
0,
0,
0,
0.012605042016806723,
0.004842615012106538,
0.00980392156862745,
0.004464285714285714,
0.014563106796116505,
0,
0,
0.006578947368421052,
0.0058823529411764705,
0.002242152466367713,
0.009868421052631578,
0.0056657223796034,
0.005263157894736842,
0,
0,
0.006369426751592357,
0,
0.009345794392523364,
0.0036231884057971015,
0.014084507042253521,
0.003484320557491289,
0.007614213197969543,
0,
0,
0,
0,
0.006880733944954129,
0,
0.004310344827586207,
0,
0,
0,
0,
0,
0.006622516556291391,
0,
0,
0.012195121951219513,
0.005952380952380952,
0.00909090909090909,
0.003703703703703704,
0.005249343832020997,
0.012461059190031152,
0,
0.0049261083743842365,
0.008097165991902834,
0.011111111111111112,
0.005291005291005291,
0,
0.009852216748768473,
0,
0.012658227848101266,
0.008310249307479225,
0,
0.00980392156862745,
0,
0.008928571428571428,
0.005722460658082976,
0.005494505494505495,
0,
0.0091324200913242,
0.005128205128205128,
0.006211180124223602,
0,
0.007042253521126761,
0.006024096385542169,
0.005714285714285714,
0.0035335689045936395,
0.013513513513513514,
0,
0.009569377990430622,
0.006550218340611353,
0,
0,
0.002061855670103093,
0,
0.00819672131147541,
0.020689655172413793,
0,
0,
0,
0,
0.003484320557491289,
0.005263157894736842,
0,
0,
0.006944444444444444,
0,
0,
0,
0,
0,
0,
0.004694835680751174,
0.027522935779816515,
0.019736842105263157,
0.009259259259259259,
0.02040816326530612,
0.0049261083743842365,
0.019867549668874173,
0.009216589861751152,
0,
0.006711409395973154,
0,
0,
0.017543859649122806,
0.023809523809523808,
0,
0,
0,
0,
0,
0.007751937984496124,
0,
0.018018018018018018,
0.011834319526627219,
0.005076142131979695,
0.012345679012345678,
0.011299435028248588,
0.016835016835016835,
0.017094017094017096,
0,
0.0045351473922902496,
0,
0.03571428571428571,
0,
0.004705882352941176,
0.034482758620689655,
0,
0.011278195488721804,
0,
0,
0.009523809523809525,
0.0273972602739726,
0.0030959752321981426,
0.006097560975609756,
0.017543859649122806,
0.020202020202020204,
0,
0,
0.00964630225080386,
0.00625,
0,
0.00510204081632653,
0.003115264797507788,
0,
0,
0,
0.011627906976744186,
0,
0.004219409282700422,
0.0057306590257879654,
0,
0.0033222591362126247,
0.016216216216216217,
0.007142857142857143,
0,
0,
0.011320754716981131,
0.010050251256281407,
0.014925373134328358,
0,
0,
0.006172839506172839,
0.006644518272425249,
0,
0.006802721088435374,
0,
0,
0.021645021645021644,
0.01,
0,
0.007639419404125287,
0.002061855670103093,
0.008830022075055188,
0.006289308176100629,
0,
0,
0,
0.015384615384615385,
0,
0,
0,
0,
0.012224938875305624,
0,
0,
0.003816793893129771,
0,
0.005747126436781609,
0.009345794392523364,
0.00980392156862745,
0,
0.009009009009009009,
0,
0,
0,
0.011363636363636364,
0,
0,
0.003205128205128205,
0.004415011037527594,
0,
0,
0.00210637177461822,
0
] | 0.005237
| 5
|
[
"Q:\n\nKnocking out the barrier between fridge and freezer?",
"\n\nI have a fridge freezer combo that I am going to convert to a serving fridge. ",
"I have done this with an old fridge before but decided to upgrade when I moved because it was really old and crapping out.",
"\nQuestion:\nWhat will happen if I cut out the majority of the barrier between the fridge and freezer? ",
"I'm concerned about everything freezing, or over/under using the refrigeration unit.",
"\nWhy:\n2 reasons, first I really want my taps at a reasonable height, second, I really think the extra height would reduce the clutter of beer and gas lines and make everything easier to manage.",
"\nNotes: I really don't want to use a secondary temp controller, will the fridge's temp controller work ok?",
"\nThe Fridge I Have:\nhttp://www.youtube.com/watch?v=_5ZSGtMB-F0 \n\nA:\n\nI don't think that this is going to work very well, stripping out the barrier between the freezer and the refrigerator. ",
" Any number of things could happen:\n\nYou risk damaging the refrigerant lines that may pass between or go around the freezer portion, \nUnless you can disable the freezer, you may find it working extra hard to try and maintain the thermostat temperature of the freezer area, which could possibly result in damaging the freezer components, \nCould end up with additional and unwanted condensation within the main part of your refrigerator.",
"\n\nUnless you know for certain what will happen, I'd suggest using your freezer space for storing hops or other things more appropriate. ",
" And like @mdma said, this is probably more appropriate in a hacking forum of sorts for appliances.",
"\n\n"
] |
{
"pile_set_name": "StackExchange"
}
|
[
0,
0,
0,
0,
0,
0,
0,
0.005291005291005291,
0,
0,
0.010101010101010102,
0
] | 0.001283
| 5
|
[
"Congenital uni-leaflet mitral valve with severe stenosis: A case report with literature review.",
"\nNumerical abnormalities of mitral leaflets is a special entity in congenital mitral malformations. ",
"Previously reported cases of uni-leaflet mitral valve were primarily related to absence or dysplasia of certain leaflets. ",
"We present a case here with mitral leaflets that were not divided into anterior and posterior as usual, but developed as an integral structure instead, which is different from previously documented cases of uni-leaflet mitral valves. ",
"Real time three-dimensional echocardiography (RT3DE) provides a visual presentation of the abnormal mitral structure which was confirmed by surgical operation. ",
"To the best of our knowledge, this unusual form of uni-leaflet mitral valve has not been reported yet."
] |
{
"pile_set_name": "PubMed Abstracts"
}
|
[
0,
0,
0,
0,
0,
0
] | 0
| 5
|
[
"This is your go-to site for information about our vibrant cultural community. ",
"You can use our map to search out and connect with the people, places, businesses and organizations that bring culture to our city every day. ",
"Just click on our map entry button below and start to explore, search and learn more about New Westminster’s cultural assets."
] |
{
"pile_set_name": "OpenWebText2"
}
|
[
0,
0,
0.008
] | 0.002667
| 5
|
[
"Q:\n\nPayment gateway for flutter\n\nHow can I integrate a payment gateway in flutter framework. ",
"Is there any libraries I can use readily? ",
"Do I need to do it separately in iOS and Android?",
"\nIn that case which is the best library available in India? ",
"\nCheck out the new package for making payment\nhttps://pub.dev/packages/flutter_paystack\n\nA:\n\nThere are no payment plugins for flutter yet.",
"\nTo integrate payments into a flutter app, just integrate payments natively and invoke it by implementing a platform channel.",
"\nAn example of platform channel implementation is shown here.",
"\nHope that helped!",
"\n\nA:\n\nDuring the Flutter live, they have announced Payment integration for the flutter App.",
"You can find the sdk from the below given link. ",
"All documentation are available on that website.",
"\nhttps://squareup.com/us/en/flutter\n\nA:\n\nI was able to integrate stripe using webview & flutter_webview_plugin\n String test = \"Test Charge\";\n int amount = 100;\n @override\n Widget build(BuildContext context) {\n return new MaterialApp(\n home: new WebviewScaffold(\n url: new Uri.dataFromString('''\n <html>\n <head>\n <meta name=\"viewport\" content=\"width=device-width\">\n </head>\n <center>\n <body> \n <form action=\"Your Server\" method=\"POST\">\n <script\n src=\"https://checkout.stripe.com/checkout.js\" class=\"stripe-button\"\n data-key=\"pk_test_key\"\n data-amount=\"$amount\"\n data-name=\"$test\"\n data-description=\"My Order\"\n data-image=\"https://stripe.com/img/documentation/checkout/marketplace.png\"\n data-locale=\"auto\"\n data-currency=\"eur\">\n </script>\n </form> \n </body>\n </center>\n </html>\n ''', mimeType: 'text/html').toString(),\n ));\n }\n\nyou'll need to set up a server for live payments. ",
"More info can be found:\nhttps://stripe.com/docs/checkout#integration-simple\n\n"
] |
{
"pile_set_name": "StackExchange"
}
|
[
0,
0,
0.02040816326530612,
0,
0.007246376811594203,
0,
0,
0,
0.01098901098901099,
0,
0,
0.007785467128027681,
0.012987012987012988
] | 0.00457
| 5
|
[
"# This file is distributed under the same license as the Django package.",
"\n#\n# Translators:\nmsgid \"\"\nmsgstr \"\"\n\"Project-Id-Version: django\\n\"\n\"Report-Msgid-Bugs-To: \\n\"\n\"POT-Creation-Date: 2015-01-17 11:07+0100\\n\"\n\"PO-Revision-Date: 2014-10-05 20:12+0000\\n\"\n\"Last-Translator: Jannis Leidel <[email protected]>\\n\"\n\"Language-Team: Luxembourgish (http://www.transifex.com/projects/p/django/\"\n\"language/lb/)\\n\"\n\"MIME-Version: 1.0\\n\"\n\"Content-Type: text/plain; charset=UTF-8\\n\"\n\"Content-Transfer-Encoding: 8bit\\n\"\n\"Language: lb\\n\"\n\"Plural-Forms: nplurals=2; plural=(n !",
"= 1);\\n\"\n\nmsgid \"Content Types\"\nmsgstr \"\"\n\nmsgid \"python model class name\"\nmsgstr \"\"\n\nmsgid \"content type\"\nmsgstr \"\"\n\nmsgid \"content types\"\nmsgstr \"\"\n\n#, python-format\nmsgid \"Content type %(ct_id)s object has no associated model\"\nmsgstr \"\"\n\n#, python-format\nmsgid \"Content type %(ct_id)s object %(obj_id)s doesn't exist\"\nmsgstr \"\"\n\n#, python-format\nmsgid \"%(ct_name)s objects don't have a get_absolute_url() method\"\nmsgstr \"\"\n"
] |
{
"pile_set_name": "Github"
}
|
[
0.013888888888888888,
0.014256619144602852,
0.004694835680751174
] | 0.010947
| 5
|
[
"[Disorders of psychological function in neurological diseases and in work capability].",
"\nThere are many different psychiatric disorders connected with neurological diseases, such as the disorders of intellectual and cognitive functions, personality changes, neurotic and psychotic behaviour. ",
"It is important for a neurologist to recognize these disorders, because they may be of great importance in evaluating work and professional capability, especially in intellectual professions. ",
"Neurologists inclined to objectivization of neurological deficit may overlook these disorders. ",
"In making an expertise it is essential to differentiate between the reversible (transitory symptoms, clouding of consciousness) and the irreversible disorders (personality changes, intellectual impairment--dementia). ",
"Also it should be kept in mind that psychopathological features of organic psychosyndromes are characterized by common psychopathological syndromes and that they represent non-specific types of reaction. ",
"Apart from diagnosing a particular psychological disorders, when making an expertise one should also describe the disorders of various psychological functions and their impact on work and professional capability and social behaviour. ",
"The author stresses the necessity of stating diagnostic criteria for the evaluation of the psychological deficit level in neurological diseases. ",
"Basic education in neurology should be accompanied by the continuous gathering of information in neuropsychology and organic psychiatry."
] |
{
"pile_set_name": "PubMed Abstracts"
}
|
[
0,
0,
0,
0,
0,
0,
0,
0,
0
] | 0
| 5
|
[
"This application relates to an image acquisition and processing technique where the image is captured utilizing a sensor which has different sensitivity levels assigned to different pixels.",
"\nImage reconstruction is inherent in any number of technical areas. ",
"As an example, surveillance aircraft capture images at multiple wavelengths which must be reconstructed to provide information. ",
"These images must be captured relatively quickly, and the accuracy, spatial resolution, and dynamic range must be as high as possible.",
"\nHowever, a natural scene usually has a very high dynamic range, i.e., very bright and very dark areas, requiring for example 20 bits, and standard imaging sensors can acquire less, for example only 8-12 bits. ",
"A traditional imaging sensor faces the problem of missing scene details or blooming or serious distortion due to limited dynamic range.",
"\nPrior art methods to capture high dynamic range (“HDR”) images may use multiple sequential exposures to obtain multiple images at different exposures. ",
"Also, they may use multiple discrete sensor arrays with different sensitivities. ",
"Further, they may fabricate a single chip with multiple different size pixels to simultaneously capture multiple images with different exposures. ",
"In yet another approach, they have attempted to integrate light flux until a pixel reaches saturation where the integration time represents the actual irradiance. ",
"One further technique is to use logarithmic response pixels or circuits to nonlinearly extend the dynamic range of a scene. ",
"Finally, physical masks or filters have been utilized with pixel-wise attenuation levels arrayed in regular patterns.",
"\nWith these techniques, the final image is obtained for display by compressing the high dynamic range constructed from the sample data.",
"\nAll of the prior art approaches have disadvantages. ",
"The approach of taking multiple sequential exposures has artifacts due to motion in the scene, since each image is from a slightly different time or length of time. ",
"Further, complicated image registration is needed to generate the final image. ",
"There are also often artifacts in reconstructed images due to occlusion or mis-registration.",
"\nThe multiple discrete sensor arrays have the problem that the light is split and reflected to different sensor arrays. ",
"The amount of light reaching a sensor is therefore less and this is not well-suited for low light imaging. ",
"The cost, size, weight, and power required are also increased due to the extra hardware.",
"\nUsing multiple size pixels decreases resolution compared to a single size pixel and, thus, also is not ideal.",
"\nIn the pixel integration time scheme, one main disadvantage is a partially opened transfer transistor could introduce an additional dark current source resulting in higher dark current shot noise. ",
"Also, drive circuits are more complex due to multiple signal reads. ",
"Additional electronics are required at correspondingly increased cost.",
"\nThe logarithmic response pixels or circuit scheme has a nonlinear response that is not preferred in most applications since it makes proper color correction difficult across the full range of the sensor output.",
"\nThe mask scheme has generally been provided with a regular grid mask, which results in low resolution or low quality due to imaging interpolation.",
"\nThus, an improved high dynamic range imaging process is desirable."
] |
{
"pile_set_name": "USPTO Backgrounds"
}
|
[
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
] | 0
| 5
|
[
"Columbia Jazz Masterpieces\n\nColumbia Jazz Masterpieces was a series of Jazz CD and LP reissues from Columbia Records circa 1990. ",
" Written inside the blue box used on all the album covers \"Digitally Remastered Directly from the Original Analog Tapes.\"",
"\n\nDiscography\nArmstrong, Louis and His All Stars - Louis Armstrong Plays W.C. Handy\nArmstrong, Louis and His All Stars - Satch Plays Fats\nArmstrong, Armstrong - Volume I through VII (comps of Hot Five and other material)\nBaker, Chet - With Strings\nBasie, Count - The Essential, Vol I\nBasie, Count - The Essential, Vol II\nBasie, Count - The Essential, Vol III\nBeiderbecke, Bix - Singin' the Blues 1 and At The Jazz Band Ball 2\nBlakey, Art - The Jazz Messengers\nBrubeck, Dave - Gone With The Wind\nBrubeck, Dave - The Great Concerts\nBrubeck, Dave - Interchanges '54\nBrubeck, Dave - Jazz Goes to College\nBrubeck, Dave - Jazz Impressions of New York\nBrubeck, Dave - Time Out\nBrubeck, Dave - West Side Story\nBrubeck, Dave - Dave Digs Disney\" (CBS 471250 2, 1994)'\nBryant, Ray - Con AlmaChristian, Charlie - Genius of the Electric GuitarClayton, Buck - Jam Sessions From The VaultCondon, Eddie & His All-Stars - Dixieland JamDavis, Miles - 58 SessionsDavis, Miles - BalladsDavis, Miles - Bitches BrewDavis, Miles - Cookin' at the Plugged NickelDavis, Miles - In a Silent WayDavis, Miles - In Person Friday and Saturday Nights at the BlackhawkDavis, Miles - Kind of BlueDavis, Miles - Live Miles, More Music from Carnegie HallDavis, Miles - Miles AheadDavis, Miles - Miles & ColtraneDavis, Miles - Miles in the SkyDavis, Miles - MilestonesDavis, Miles - On the CornerDavis, Miles - Porgy and BessDavis, Miles - Round About MidnightDavis, Miles - Sketches of SpainDavis, Miles - Someday My Prince Will ComeDavis, Miles - SorcererDavis, Miles - \"Seven Steps to Heaven\" (CBS 466970 2, 1992)\nEldridge, Roy - Little Jazz, Uptown (w/Gene Krupa & Anita O'Day)\nEllington, Duke - Blues in OrbitEllington, Duke - The Duke's Men Vol 1 & 2Ellington, Duke - Ellington at NewportEllington, Duke - Ellington IndigosEllington, Duke - Ellington UptownEllington, Duke and Basie, Count - First Time! ",
"The Count Meets the DukeEllington, Duke - Jazz PartyEllington, Duke - The Okeh EllingtonEllington, Duke - Three SuitesGarner, Erroll - Body and SoulGarner, Erroll - Concert by the SeaGarner, Erroll - Long Ago and Far AwayGetz, Stan - LyricalGoodman, Benny - The Benny Goodman Sextet Featuring Charlie Christian: 1939-1941Goodman, Benny - Benny Goodman Sextet\" (CBS 450411 2, 1987)\nGoodman, Benny - Live at Carnegie Hall\nGoodman, Benny - On the Air 1937-1938\nGoodman, Benny - Slipped Disc\nGoodman, Benny - Small Groups 1941-45\nGoodman, Benny - Vol I, Roll 'Em\nGoodman, Benny - Vol II, Clarinet A La King\nGoodman, Benny - Vol III, All The Cats Join In\nGordon, Dexter - Homecoming\nHayes, Tubby w/Clark Terry - The New York Sessions\nHerman, Woody - The Thundering Herds\nHines, Earl - Live at the Village Vanguard\nHoliday, Billie - Lady in Satin\nHoliday, Billie - The Quintessential, Vols. ",
"1-9\nJohnson, J. J. - The Trombone Master\nLambert, Hendricks & Ross - Everybody's Boppin'''\nMingus, Charles - Ah UmMingus, Charles - Let My Children Hear MusicMingus, Charles - Mingus Dynasty (also released as Shoes of the Fisherman)\nMonk, Thelonious - ComposerMonk, Thelonious - Criss-CrossMonk, Thelonious - Monk's DreamMonk, Thelonious - StandardsMonk, Thelonious - UndergroundRouse, Charlie - Unsung HeroSmith, Bessie - CollectionSmith, Willie w/the Harry James Orchestra - Snooty FruityWebster, Ben - Ben and \"Sweets\"Various artistsThe Bebop EraThe Jazz Arranger, Vol 1 & 2The Sound Of JazzSample Vol IV through IVThe Jazz MastersJazz Masterpieces Sampler Vol IJazz Masterpieces Sampler Vol IIJazz Masterpieces Sampler Vol IIIJazz Masterpieces Sampler Vol IVJazz Masterpieces Sampler Vol VThe 1930s - Big BandsThe 1930s - Small CombosThe 1930s - The SingersThe 1940s - The Small Groups: New DirectionsThe 1940s - The SingersThe 1950s - The Singers''\n\nCategory:American record labels\n \n \nCategory:Jazz record labels"
] |
{
"pile_set_name": "Wikipedia (en)"
}
|
[
0.015503875968992248,
0.00819672131147541,
0.027762947143619862,
0.02824858757062147,
0.01669941060903733
] | 0.019282
| 5
|
[
"Q:\n\nSpecifying nodes on horizontal lines\n\nI have tried several to draw a graph representing with consecutive states in a straight line, S0 -> S1 -> S2. ",
" Then actions in another straight line below. ",
" There are edges between S0 -> A0 -> S1 -> A1 -> S2. ",
" Which forms triangles lined up next to each other.",
"\n\nI have tried to use a cluster, and rank=same for the nodes I want to align. ",
" I also tried to use [constraint=false] and other answers on Stack Overflow.",
"\n\\begin{dot2tex}[fdp]\ndigraph G {\n newrank=true;\n node[group=\"states\"]\n S0 [texlbl=\"$S_{t-2}$\", shape=none];\n S1 [texlbl=\"$S_{t-1}$\", shape=none];\n S2 [texlbl=\"$S_t$\", shape=none];\n S3 [texlbl=\"$S_{t+1}$\", shape=none];\n node[group=\"\"]\n A0 [texlbl=\"$A_{t-2}$\", shape=none];\n A1 [texlbl=\"$A_{t-1}$\", shape=none];\n A2 [texlbl=\"$A_t$\", shape=none];\n { rank=same; S0; S1; S2; S3;\n S0 -> S1-> S2 -> S3;\n S0 -> A0;\n S1 -> A1;\n S2 -> A2; }\n A0 -> S1;\n A1 -> S2;\n A2 -> S3;\n}\n\\end{dot2tex}\n\nHowever the output from the graph is a mixture of states and actions on a curve.",
"\n\nA:\n\nYour code looks like part of a LaTeX document but it wouldn't work for me; dot2tex is, as far as I can see, a Python script that produces LaTeX code. ",
"But I'm out of my depth here, it seems to work for you.",
"\nWhat I have done - I have corrected the mistake you have made, putting the closing brace } for the rank = same instruction back into that same line, and took it out of the apparent LaTeX environment; I also changed the arrow direction for the edges showing \"upwards\". ",
"Then I commented out the unnecessary instructions, arriving at\ndigraph G {\n# newrank=true;\n# node[group=\"states\"]\n S0 [texlbl=\"$S_{t-2}$\", shape=none];\n S1 [texlbl=\"$S_{t-1}$\", shape=none];\n S2 [texlbl=\"$S_t$\", shape=none];\n S3 [texlbl=\"$S_{t+1}$\", shape=none];\n# node[group=\"\"]\n A0 [texlbl=\"$A_{t-2}$\", shape=none];\n A1 [texlbl=\"$A_{t-1}$\", shape=none];\n A2 [texlbl=\"$A_t$\", shape=none];\n { rank=same; S0; S1; S2; S3; }\n S0 -> S1-> S2 -> S3;\n S0 -> A0;\n S1 -> A1;\n S2 -> A2;\n edge[ dir = back ];\n S1 -> A0;\n S2 -> A1;\n S3 -> A2;\n}\n\nConverting this to a LaTex document with\ndot2tex -ftikz x > x.tex\n\nI get\n\nwhich I guess is what you want, or at least, what your code will produce. ",
"Your workflow may be different, but if you correct the main mistake and move the closing brace where it belongs, you should be done. ",
"Note that dot2tex uses the dot engine by default, which is what you should be doing, as rightly pointed out be @Dany.",
"\nIf you want something that is close to the picture in your post, try\ndigraph G \n{\n node[ shape =none ]\n\n S [ label = \"\" ];\n S0 [ texlbl=\"$S_{t-2}$\" ];\n S1 [ texlbl=\"$S_{t-1}$\" ];\n S2 [ texlbl=\"$S_t$\" ];\n S3 [ texlbl=\"$S_{t+1}$\" ];\n\n A0 [ texlbl=\"$A_{t-2}$\" ];\n A1 [ texlbl=\"$A_{t-1}$\" ];\n A2 [ texlbl=\"$A_t$\" ];\n\n { rank=same; S S0 S1 S2 S3 }\n S0 -> S1 -> S2 -> S3\n\n S0 -> A1;\n S1 -> A2;\n edge[ dir = back ];\n S0 -> A0;\n S1 -> A1;\n S2 -> A2;\n\n edge[ style = invis ];\n S -> S1\n S -> A0;\n}\n\n"
] |
{
"pile_set_name": "StackExchange"
}
|
[
0,
0,
0,
0,
0,
0,
0.006493506493506494,
0.01282051282051282,
0,
0.0037174721189591076,
0.005420054200542005,
0,
0.017094017094017096,
0.003629764065335753
] | 0.003513
| 5
|
[
"Thomas Artemus Jones\n\nHis Honour Sir Thomas Artemus Jones KC LLD (1871 – 15 October 1943), was a Welsh Judge, journalist, nationalist and Liberal Party politician who campaigned for the Welsh language.",
"\n\nBackground\nJones was born in Denbigh, the youngest son of stonemason Thomas Jones. ",
"In 1927 he married Mildred Mary David. ",
"He was knighted in 1931.",
"\n\nPolitical career\nJones was a Liberal and first active in the Cymru Fydd movement, along with David Lloyd George. ",
"He was selected as Liberal candidate for Merthyr against James Keir Hardie in 1913, for a General Election expected to take place in 1914/15. ",
"After the Liberal Party split between supporters of the Coalition government led by Lloyd George and those of the opposition Liberals led by H.H. Asquith, Jones sided against Lloyd George. ",
"After 1918 he sought the Liberal nomination in the Gower constituency but his hostility to the Coalition Government did not go down well and he did not win the nomination. ",
"In 1922, with Liberals opposed to Lloyd George struggling to find Welsh constituencies willing to adopt them, he was forced to look elsewhere and was adopted in the unpromising seat of Macclesfield, where no Liberal had stood at the previous election. ",
"Despite this, at the general election he came second, comfortably pushing the Labour candidate into third place. ",
"Following Liberal reunion in 1923, he was able to get adopted to contest a Welsh constituency. ",
"He was chosen for the marginal Labour seat of Swansea East, which the Liberals had lost in 1922. ",
"However, he failed to take the seat from Labour at the 1923 General Election. ",
"In 1924 he was chosen to be the Liberal candidate with the task of retaining the marginal seat of Keighley. ",
"However, a Unionist candidate intervened in the contest and Jones was edged into third place. ",
"He did not stand for parliament again. ",
"He campaigned for a repeal of section 17 of the 1536 Act of Union which gave no legal status to the Welsh language. ",
"He highlighted a particular legal case in 1933 when the chairman, jurors, advocates, the justices, the prisoner and all the witnesses spoke Welsh, yet the trial had to be conducted in English because the court shorthand writer was an Englishman who spoke no Welsh. ",
"Following a UK wide petition, the section was repealed by the Welsh Courts Act of 1942. ",
"He was a key supporter of the Liberal William John Gruffydd in the 1943 University of Wales by-election. ",
"He was one of the first people to call for an appointment of a Secretary of State for Wales.",
"\n\nIn 1944 his autobiography Without my Wig was published.",
"\n\nElectoral record\n\nExternal links\nCymru Culture: http://www.cymruculture.co.uk/featuredarticles_94921.html\n\nReferences\n\nCategory:1871 births\nCategory:1943 deaths\nCategory:Liberal Party (UK) parliamentary candidates\nCategory:Members of the Middle Temple"
] |
{
"pile_set_name": "Wikipedia (en)"
}
|
[
0.014925373134328358,
0.023529411764705882,
0.02564102564102564,
0,
0.008695652173913044,
0.007042253521126761,
0.026455026455026454,
0.005813953488372093,
0.007936507936507936,
0,
0,
0,
0,
0.009259259259259259,
0.010638297872340425,
0,
0,
0.0037735849056603774,
0.011363636363636364,
0.01904761904761905,
0.010869565217391304,
0.017543859649122806,
0.011857707509881422
] | 0.009321
| 5
|
[
"BLUEBERRY CINNAMON CRUMBLE DECAF\n\nRegular price\n$ 12.95\nSale\n\nBag Size\n\nGrind\n\nQuantity\n\nNOTES:Delicious cinnamon and true blueberry flavors in a decaffeinated coffee.",
"\n\nMORE:12-ounce bag. ",
"Choice of Grind. ",
"Resealable Kraft bag with zipper closer and one-way degassing valve. ",
"West End Coffee Roasters established in Greenville, SC in 1992 has been roasting specialty coffees for more than 25 years. ",
"Every coffee is hand roasted daily in small batches.",
"All coffee is roasted to order, this ensures you get the freshest coffee possible delivered directly to your door. ",
"We stand behind every bag of coffee we sell and your complete satisfaction is always 100% guaranteed.",
"\n\nBACKGROUND:Our flavored coffees contain natural and artificial flavorings. ",
"They do not contain any sugar or ethanol alcohol."
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0,
0,
0,
0.014492753623188406,
0.008130081300813009,
0,
0,
0,
0,
0
] | 0.002262
| 5
|
[
"The doctor said I can't have sex for six weeks What did the dentist say?",
"\n\n1,987 shares"
] |
{
"pile_set_name": "OpenWebText2"
}
|
[
0,
0
] | 0
| 5
|
[
"I will not be able to attend this meeting.",
"\n\n\n\n\nGeynille Dillingham\n08/18/2000 02:57 PM\nTo: Jere C Overdyke/HOU/ECT@ECT, Greek Rice/Corp/Enron@ENRON, Randal \nMaffett/HOU/ECT@ECT, Edward Coats/Corp/Enron@ENRON, Amanda K \nMartin/HOU/AZURIX@AZURIX, Stephen Schwarz, Joseph Deffner/HOU/ECT@ECT, Brenda \nF Herod/HOU/ECT@ECT, Eric Scott/HOU/ECT@ECT, Homer Lin/HOU/ECT@ECT, Robin \nRodrigue/HOU/ECT@ECT, Paul Pizzolato/HOU/ECT@ECT, Kevin Hughes/HOU/EES@EES, \nSusan Harrison/HOU/ECT@ECT, Melissa White/Enron Communications@Enron \nCommunications, Andrea Price/Corp/Enron@ENRON, Michelle \nLeBlanc/Corp/Enron@ENRON, Timothy Blanchard/HOU/EES@EES, Benjamin \nMarkey/HOU/ECT@ECT, Hang Bui/HOU/ECT@ECT, Bryan Hull/HOU/ECT@ECT, Shanna \nHusser/HOU/EES@EES, Chad Landry/HOU/ECT@ECT, Mary Perkins/HOU/ECT@ECT\ncc: Donna Baker/HOU/ECT@ECT, Donna Hutton/Corp/Enron@Enron, Beth A \nRyan/HOU/ECT@ECT, Yvette G Connevey/Corp/Enron@ENRON \nSubject: LSU TEAM MEETING\n\nHello LSU Recruiting Team,\n\nYou have been chosen to represent and assist in the Fall 2000 recruiting \nefforts at Louisiana State University for Enron's Associate/Analyst Program.",
"\n\nWe are excited about the upcoming association,and welcome you to the team. ",
"We\nhave arranged a lunch meeting to discuss the details.",
"\n\n\nPlease read the following attachment for information concerning the meeting\ntime and place. ",
" If you will not be able to attend, please r.s.v.p your \nregrets.",
"\n\n\n\n\n\nSee you soon!",
"\n\n\n\nRecruiter, Geynille Dillingham\nCoordinator, Debbie Flores"
] |
{
"pile_set_name": "Enron Emails"
}
|
[
0,
0.03727865796831314,
0,
0,
0,
0,
0,
0.04918032786885246
] | 0.010807
| 5
|
[
"48 F.3d 1213\nU.S.v.",
"Bermudez\nNO. ",
"94-1031\nUnited States Court of Appeals,Second Circuit.",
"\nDec 27, 1994\nAppeal From: S.D.N.Y.92-cr-226\n\n1\nAFFIRMED.",
"\n\n"
] |
{
"pile_set_name": "FreeLaw"
}
|
[
0,
0,
0.037037037037037035,
0,
0
] | 0.007407
| 5
|
[
"Eddie Peng (third from left) plays the leading role in The Rescue, directed by Dante Lam, one of three Hong Kong directors whose films were vying to be top dog at the Lunar New Year box office in China until distributors delayed their release because of the Wuhan coronavirus outbreak."
] |
{
"pile_set_name": "OpenWebText2"
}
|
[
0.010526315789473684
] | 0.010526
| 5
|
[
"product description page\n\nAlternative Facts Journal (Paperback)\n\nAbout this item\n\nRecord your to-do list, or your won’t-do list. ",
"Jot down your thoughts, note your lack of ideas. ",
"Keep track of your dreams and collect your nightmares. ",
"On January 22, two days into the Trump presidency, White House senior advisor Kellyanne Conway appeared on Meet the Press and claimed that the administration was offering “alternative facts” to assertions about the crowd size at Trump’s inauguration. ",
"Conway’s remarks struck a chord, or rather a dissonant note, with viewers, who reacted with scathing commentary and biting memes. ",
"After a tumultuous few weeks of politics, this lined journal says “Always remember: the facts are whatever you want them to be.”",
"\n\nHere is one fact: All royalties from the sale of this journal will be donated to ProPublica, an independent, nonprofit newsroom that produces investigative journalism in the public interest. ",
"For more information visit www.propublica.org."
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0.007751937984496124,
0.02040816326530612,
0,
0.0199203187250996,
0,
0,
0.0051813471502590676,
0.021739130434782608
] | 0.009375
| 5
|
[
"Category: Certified Dating Services\n\nMen and women tend to be reported to be from various planets. ",
"Yes, they vary within an amount of ways – from look to therapy, nonetheless they can’t stay without one another. ",
"They have been mutually attracted. ",
"In terms of intimate interactions involving the opposing sexes, the associates of each and every aim To be attractive in the optical eyes of these potential partner. ",
"Although destination takes place normally and sometimes out of nowhere, there are numerous universal Triggers that each woman and man should become aware of. ",
"Therapy will there be to Help the workings are understood by you of destination better.",
"\n\nThe character of Female Attraction: an insight that is deep\n\nWhenever men wonder “What do women want?”, ",
"in addition they mean “ just just just just What attracts females in males?” ",
"women can be really particular when it comes to picking a partner that is romantic. ",
"They tend to be instinctively hunting for the best & most male that is reliable this is something profoundly ingrained within their subconsciousness since the primeval times. ",
"Appearance matters too. ",
"There are many attraction killers, such as for instance unwanted weight, boldness, untidiness, that turn a female down. ",
"Consequently, great body, created muscles, great tresses and epidermis, style in clothes will act as feminine destination triggers. ",
"A lady can be seduced by actual attractiveness, but this is sufficient just for a brief period of the time|period that is short of. ",
"She’ll then gauge the guy by her other criteria regarding their character and personality. ",
"On a deeper level, she will not if he doesn’t attract her keep on with this commitment."
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0,
0,
0,
0,
0,
0,
0.009433962264150943,
0,
0,
0,
0,
0,
0,
0,
0,
0
] | 0.00059
| 5
|
[
"Complete Season 2 DVD Boxed Set\n\nThe Pat Callinan’s 4X4 Adventures Season 2 DVD Boxed Set, makes up seven different episodes featuring 4X4 travel that you won’t want to miss. ",
"Get behind the wheel with Mr 4X4, Pat Callinan, on our best season of 4X4 travel yet.",
"\n\nThe Pat Callinan’s 4X4 Adventures Season 2 DVD Boxed Set, makes up seven different episodes featuring 4X4 travel that you won’t want to miss. ",
"Get behind the wheel with Mr 4X4, Pat Callinan, on our best season of 4X4 travel yet. ",
"You’ll be informed and inspired by these destinations, as Pat shows you some of the most stunning areas to explore. ",
"There are two trips in beautiful Tasmania, taking in the eastern and western areas. ",
"You’ll also explore the Northern Territory’s epic Red Centre, complete the eastern NSW trek from Barrington Tops to Stockton Beach, travel through WA’s Esperance to Kalgoorlie and explore the iconic Canning Stock Route."
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0,
0.011764705882352941,
0,
0.011627906976744186,
0.008620689655172414,
0.011904761904761904,
0.0136986301369863
] | 0.008231
| 5
|
[
"Determination of tolerance to antibiotic bactericidal activity on Kirby-Bauer susceptibility plates.",
"\nA rapid method utilizing Kirby-Bauer susceptibility plates was developed to determine bacterial tolerance to antibiotic bactericidal activity. ",
"After completion of initial antibiotic disk susceptibility testing, the disks containing cephalothin, cefazolin, nafcillin, oxacillin, and methicillin were removed and replaced with disks containing a potent beta-lactamase. ",
"The plates were reincubated for 18-24 hours and examined for regrowth of organisms within the original zone of inhibition. ",
"For 15 of 16 patients who had serious Staphylococcus aureus infections, the method correlated with clinical outcome of antibiotic chemotherapy. ",
"Broth dilution tests for bactericidal activity only correlated with clinical response for 11 of 16 patients. ",
"One hundred consecutive clinical S. aureus isolates tested with the new method demonstrated tolerance in 27% of strains to cephalothin, 15% to cefazolin, 1% to oxacillin, and 2% of nafcillin."
] |
{
"pile_set_name": "PubMed Abstracts"
}
|
[
0.01,
0.006944444444444444,
0.008928571428571428,
0,
0.006944444444444444,
0,
0.010471204188481676
] | 0.006184
| 5
|
[
"1 Peter (Program #10) -The Full Salvation of the Triune God and Its Issues (8)\n\nAs believers in the Lord Jesus Christ, we accept the Bible as truth. ",
"John 17 says specifically, “Sanctify them in the truth; Your word is truth.” ",
"And so when we come to verses such as John 3:16 for example, “for God so love the world that He gave His only begotten Son.” ",
"We take that as truth without question. ",
"But are we satisfied merely to accept the objective fact that God surely loves us or have we in fact experienced His love in a personal and subjective way?",
"\n\nThe apostle Peter was one, whom no doubt knew the objective teaching of God’s love. ",
"But it must have been his deep and personal experience and appreciation of the loving Savior that prompted him to write in the deeply and experiential manner that we find in his New Testament epistles.",
"\n\nColossians 1:13 says, “Who delivered us out of the authority of darkness and transferred us into the kingdom of the Son of His love”. ",
"This is a marvelous verse that is well beloved by many that love the Lord Jesus especially those whose background is easily described by the phrase “authority of darkness”. ",
"If we had a particularly sinful and dark past then likely our appreciation of this transfer is quite keen. ",
"To many others that may not have such an evil and wicked past seemingly, so while they may agree doctrinally that such a transfer has taken place, the heartfelt realization may not be quite as strong. ",
"But what was the apostle Paul referring to when he wrote these words to the believers in Colossi? ",
"The answer to this question will likely surprise you.",
"\n\nPsalms (Program #34) – God’s Recovery of His Title and Right Over the Whole Earth Through the Reign of Christ\n\nOften times when we are visiting a new country or a region we are not familiar with, our appreciation of that place will depend on the guide that is showing us around. ",
"Without a knowledgeable and experienced guide we likely will not perceive much of the hidden beauty nor appreciate the richness of all that we are seeing. ",
"Actually this could also describe our understanding of the Scriptures. ",
"Of course, we need to read and read again and re-read again in a prayerful way, the Bible to allow the Lord to reveal His Word to us. ",
"But in addition to our personal reading, we need a guide. ",
"Just as the Ethiopian eunuch did in Acts chapter 8, more…\n\nAll genuine believers in Christ know that an essential of the Christians faith is that Christ our Savior is sinless. ",
"In fact the Bible tells us in 2 Corinthians that He did not know sin. ",
"Yet the very same verse tells us that this One that did not know sin, was made sin. ",
"Here is chapter 5:\n\n21 “Him who did not know sin He made sin on our behalf that we might become the righteousness of God in Him.”",
"\n\nWhat mysterious, marvelous language. ",
"He, Who did not know sin, was made sin on our behalf. ",
"We, who believed treasure the fact that He died for our sins. ",
"Yet do we really have the proper understanding, a proper appreciation of the fact that according to God’s word that He was made sin on our behalf?",
"\n\nTo our natural understanding the structure of a book like 1 Corinthians may seem random and really lacking any particular significance. ",
"But if we realize that the book is specifically arranged with the last half of the book focused on how God is administrating the entire universe for the accomplishment of His eternal purpose, we will have a key to open a much deeper understanding and appreciation of this portion of Scripture. ",
"It’s particularly important to use this key when we come to the matter of the gifts of the spirit in 1 Corinthians chapter twelve.",
"\n\nExodus (Program #143) – The Golden Incense Altar (4) Appreciation of the Two Altars, Two Altars in our Experience\n\n“But seek first His kingdom and His righteousness and all these things will be added to you.” ",
"This is a frequently quoted passage from Matthew chapter 6. ",
"Of course, in context “all theses things” refer to our practical and physical needs and the promise is very clear; if we are occupied by seeking God’s kingdom and God’s righteousness, we need not be consumed with praying for our own needs. ",
"But what is it to seek the kingdom and God’s righteousness?"
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0,
0.012987012987012988,
0,
0,
0,
0.011627906976744186,
0,
0,
0,
0,
0,
0.01020408163265306,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
] | 0.001055
| 5
|
[
"Hepatocellular carcinoma (HCC) is the fifth most common cancer and the third most common cause of cancer-related deaths worldwide.^[@bib1]^ Most cases of HCC are associated with hepatitis B virus (HBV) infections in East Asia. ",
"It has been reported that the lifetime risk of HBV carriers to develop HCC was much higher than healthy individuals.^[@bib2],\\ [@bib3]^ As the prognosis of HCC remains unsatisfactory even after curative resection, further investigation on molecular and hereditary mechanism is needed to achieve better prognosis.^[@bib4]^\n\nFamiliar clustering of HCC has been frequently documented in East Asia. ",
"A recent study has found that family history of HCC multiplies the risk of HCC in patients with HBV infection, and recommends that HBV patients need further refinement of HCC surveillance strategy that could be personalized based on the status of family history.^[@bib5],\\ [@bib6]^ Accumulating evidence revealed that genetic factors may contribute to familiar clustering of HCC.^[@bib7],\\ [@bib8]^ However, the underlying mechanism of the pathogenesis and progression of HBV-related HCC associated with family history remains to be not clear.",
"\n\nMicroRNAs (miRNAs) are small noncoding RNAs that behave as a ubiquitous feature to modulate key cellular processes involved in carcinogenesis.^[@bib9]^ Evaluation of changes in miRNA levels show promise as biomarkers for early detection, diagnosis, and prognosis.^[@bib10],\\ [@bib11]^ Increasing evidence also supports the role of miRNAs as potential therapeutic targets for multiple diseases.^[@bib12]^ Our previous study detected miRNA profiles of the plasma of HBV-associated HCC patients with a family history of HCC that showed that miR-3188 was the markedly overexpressed miRNA in previous chip profiles and its functions have not been elucidated in HCC.^[@bib13]^ Therefore, the key signatures of miR-3188 deserve further investigations.",
"\n\nIn this study, we explored the expression pattern of miR-3188 in HCC and its clinical significance, and sought to manipulate miR-3188 expression in human HCC cell lines by the CRISPR/Cas9 genome editing technology. ",
"The role of miR-3188 in HCC and the underlying mechanism of miR-3188 regulation and cancer-related signaling pathways were further investigated.",
"\n\nResults\n=======\n\nMiR-3188 is overexpressed in HBV-associated HCC and its expression is associated with poor clinical outcome\n-----------------------------------------------------------------------------------------------------------\n\nIn our previous study, Agilent miRNA Base 16.0 microarray (Agilent Technologies, Santa Clara, CA, USA) showed that miR-3188 was 124.57-fold overexpressed in the plasma of patients with HBV-associated HCC compared with that of healthy volunteers. ",
"This result was validated by measuring miR-3188 expression in the plasma of 10 patients with HBV-associated HCC and 10 healthy volunteers using qRT-PCR (*P*\\<0.01; [Figure 1a](#fig1){ref-type=\"fig\"}). ",
"Furthermore, miR-3188 expression was detected using qRT-PCR in 150 pairs of HBV-associated HCC patients' tumor tissues and corresponding adjacent liver tissues that revealed that miR-3188 expression was significantly overexpressed in HCC tissues than in adjacent liver tissues (*P*\\<0.01; [Figure 1b](#fig1){ref-type=\"fig\"}).",
"\n\nKaplan--Meier log-rank analysis indicated that HBV-associated HCC patients with high miR-3188 expression had significantly shorter median disease-free survival (DFS) (15 *versus* 39 (months), *P*\\<0.01, [Figure 1c](#fig1){ref-type=\"fig\"}) and significantly shorter median overall survival (OS) compared with those with low miR-3188 expression (28 *versus* 66 (months), *P*\\<0.01, [Figure 1d](#fig1){ref-type=\"fig\"}). ",
"Then, we examined the correlation between miR-3188 expression level and the clinicopathological variables in patients with HBV-associated HCC. ",
"MiR-3188 overexpression was significantly correlated with elevated serum HBV DNA and *α*-fetaprotein (AFP) level (*P*\\<0.05; [Supplementary Table 2](#sup1){ref-type=\"supplementary-material\"}). ",
"We also analyzed the prognostic factors influencing OS. ",
"Univariate analysis showed that overexpression of miR-3188, elevated serum HBV DNA level, elevated serum AFP level, multiple tumors, vascular invasion, and TNM stage were associated with worse OS. ",
"Multivariate analysis using Cox's proportional hazards model showed that overexpression of miR-3188, vascular invasion, and TNM stage were independent prognostic factors for OS ([Supplementary Table 3](#sup1){ref-type=\"supplementary-material\"}).",
"\n\nMiR-3188 knockout by CRISPR/Cas9\n--------------------------------\n\nConsidering the terminal loop region controls microRNA processing by Drosha and Dicer, single-guide RNA (sgRNA) was designed within Drosha processing sites using CRISPR DESIGN ([Supplementary Figure 1a](#sup1){ref-type=\"supplementary-material\"}). ",
"The sgRNA was subcloned into the plasmid lentiCRISPR v2 containing two expression cassettes, hSpCas9 and the chimeric guide RNA. ",
"Then, we transfected the plasmids into HCC cell lines, HepG2 and SMMC7721, and performed T7 endonuclease I assay to detect the CRISPR efficiency 72 h after transfection. ",
"Indels generated by CRISPR/Cas9 indicated the cleavage of genome DNA ([Supplementary Figure 1b](#sup1){ref-type=\"supplementary-material\"}). ",
"DNA sequencing confirmed the sequence of indels adjacent to PAM sequence ([Supplementary Figure 1c](#sup1){ref-type=\"supplementary-material\"}). ",
"As shown in [Supplementary Figure 1d](#sup1){ref-type=\"supplementary-material\"}, in the HepG2 and SMMC7721 cells transfected with designated CRISPR/Cas9 sgRNA compared with the control vectors, the expression levels of mature miR-3188 declined up to 72.4 and 91.1%, and the expression levels of pri-miR-3188 increased up to 83.1 and 91.2%. ",
"Knockout (KO) of miR-3188 by CRISPR/cas9 can markedly upregulate the expression of ZHX2 ([Supplementary Figure 1e](#sup1){ref-type=\"supplementary-material\"}).",
"\n\nMiR-3188 KO suppresses cell growth and colony formation, inhibits cell cycle progression, and triggers apoptosis in HCC cells\n-----------------------------------------------------------------------------------------------------------------------------\n\nTo study the effects of miR-3188 KO on HCC cells, miR-3188 KO stably transfected sgRNA-miR-3188 clones and control clones were used for further experiments. ",
"The qRT-PCR analysis confirmed that miR-3188 KO cell clones showed much lower level of miR-3188 than those of control cells after 1 month of transfection (*P*\\<0.01, [Figure 2a](#fig2){ref-type=\"fig\"}). ",
"The CCK-8, colony formation, and anchorage-independent cell growth assays revealed that downregulation of miR-3188 significantly inhibited cell growth and colony formation of HepG2 and SMMC7721 cells ([Figures 2b--d](#fig2){ref-type=\"fig\"}).",
"\n\nTo further investigate the mechanism of cell growth inhibition of miR-3188 KO in HCC cells, we did cell cycle distribution and apoptosis analysis using flow cytometry. ",
"The results indicated that miR-3188 KO significantly increased the cell percentages in G0/G1 phase and decreased the cell percentages in S phase ([Figures 2e and f](#fig2){ref-type=\"fig\"}). ",
"Our data also indicated that miR-3188 KO significantly induced apoptosis in HCC cells. ",
"The apoptotic rates of control and miR-3188 KO of HepG2 cells were 3.73±0.71 and 16.73±1.35%, respectively, and the apoptotic rates of SMMC7721 control and miR-3188 KO cells were 4.66±0.66 and 18.39±2.42%, respectively ([Figures 2g and h](#fig2){ref-type=\"fig\"}). ",
"Analysis of potential cell cycle regulators indicated that downregulation of miR-3188 in HepG2 cells decreased Cyclin A and Cyclin E protein levels. ",
"Western blotting showed that miR-3188 KO led to a significant increase of apoptosis ([Supplementary Figure 2a](#sup1){ref-type=\"supplementary-material\"}). ",
"These data suggest that miR-3188 KO suppresses cell cycle progression and induces apoptosis, and this may explain the underlying mechanism of miR-3188 KO-induced cell growth inhibition.",
"\n\nMiR-3188 KO decreases migration and invasion of HCC cells\n---------------------------------------------------------\n\nA wound healing assay for cell migration was performed in miR-3188 KO and control clones of HepG2 and SMMC7721. ",
"Expectedly, miR-3188 KO significantly decreased migration in both HCC cells (*P*\\<0.01; [Figures 2i--j](#fig2){ref-type=\"fig\"}). ",
"In addition, the transwell chamber migration and invasion assay revealed that miR-3188 KO significantly reduced migration and invasion in both HCC cells (*P*\\<0.01; [Figures 2k and l](#fig2){ref-type=\"fig\"}). ",
"Moreover, we found that miR-3188 KO inactivated the Notch1 pathway in HepG2 cells ([Supplementary Figure 2b](#sup1){ref-type=\"supplementary-material\"}). ",
"Taken together, miR-3188 KO inhibited malignant features in HCC cells.",
"\n\nZHX2 is a direct target of miR-3188 in HCC cells\n------------------------------------------------\n\nTo investigate the miR-3188 target in HCC, we applied miRNA target predicted databases (TargetScan and MiRDB) to identify potential target genes. ",
"ZHX2 was identified as a target by both miRNA databases. ",
"Schematic diagram of putative has-miR-3188 binding site in the 3′-UTR of ZHX2 is shown in [Figure 3a](#fig3){ref-type=\"fig\"}. ",
"To determine whether ZHX2 was regulated by miR-3188, qRT-PCR and western blot assays were performed in miR-3188 overexpression or knockout and corresponding control cells. ",
"Both mRNA and protein levels of ZHX2 were downregulated by increased miR-3188 or upregulated via miR-3188 KO. ([",
"Figure 3b](#fig3){ref-type=\"fig\"} and [Supplementary Figure 2b](#sup1){ref-type=\"supplementary-material\"}). ",
"To further confirm that miR-3188 directly targets ZHX2, we constructed a wild-type ZHX2 3\\'-UTR luciferase reporter vector. ",
"MiR-3188 overexpression significantly reduced the luciferase activity from wild-type ZHX2 3\\'-UTR luciferase reporter construct. ",
"This profound inhibition was abolished when the putative miR-3188 target sequences in the ZHX2 3′-UTR were mutated in the vector, indicating that miR-3188 inhibits ZHX2 by sequence targeting ([Figure 3c](#fig3){ref-type=\"fig\"}). ",
"Moreover, the abundance of miR-3188 was inversely correlated with low expression levels of ZHX2 in HCC tissues (*R*^2^=0.508, *P*\\<0.01; [Figure 3d](#fig3){ref-type=\"fig\"}). ",
"To elucidate whether the reduction of ZHX2 could rescue the antitumor effects of miR-3188 KO, we transfected HepG2 cells with miR-3188 KO plus siZHX2. ",
"The reduced ZHX2 expression partially reversed the antitumor effects induced by miR-3188 KO ([Figures 3e--l](#fig3){ref-type=\"fig\"}). ",
"These results suggested that miR-3188 directly targets ZHX2 expression, and downregulation of ZHX2 can reverse antitumor effects of miR-3188 KO in HCC cells.",
"\n\nMiR-3188 KO inhibits human HCC xenografts growth in nude mice\n-------------------------------------------------------------\n\nTo examine whether miR-3188 KO could inhibit malignant features of HCC *in vivo*, subcutaneous tumor models were established in the flanks of athymic nude mice with miR-3188 KO and control clones. ",
"We found that miR-3188 KO could markedly inhibit the tumor growth ([Figure 4a](#fig4){ref-type=\"fig\"}). ",
"The growth curves showed that the average fold increase of miR-3188 KO tumor volumes at the time of killing was much smaller than that in control tumors (HepG2 models: 5.93±0.73 *versus* 9.79±1.45; SMMC721 models: 9.52±2.63 *versus* 13±1.6; *P*\\<0.01; [Figure 4b](#fig4){ref-type=\"fig\"}), and the average weight of miR-3188 KO tumors was significantly lighter than that in control tumors (HepG2 models: 212±21.21 *versus* 420±24.34; SMMC721 models: 327.4±25.07 *versus* 528.8±35.86; *P*\\<0.01; [Figure 4b](#fig4){ref-type=\"fig\"}).",
"\n\nThen, we explored the underlying mechanisms of tumor suppression induced by miR-3188 KO. ",
"Immunohistochemical staining assay indicated that the Notch-1 signaling pathway was markedly inactivated and expression of Ki67 was reduced, and TUNEL assay demonstrated that apoptotic rate was markedly higher in the resected tumors derived from the miR-3188 KO cells compared with control cells ([Figure 4c](#fig4){ref-type=\"fig\"}).",
"\n\nTo further evaluate the effect of miR-3188 KO on HCC tumor growth, we established an orthotopic tumor model in nude mice. ",
"The results showed that the average tumor volume derived from HepG2-miR-3188 KO cells was significantly smaller than the tumors derived from control cells (2.35±0.26 *versus* 3.85±0.3; *P*\\<0.05; [Figure 4d](#fig4){ref-type=\"fig\"}). ",
"Immunohistochemical staining study indicated that expression of Ki67 was decreased in the miR-3188 KO tumors compared with the control group.",
"\n\nMoreover, intraperitoneal xenograft models were established to evaluate the effect of miR-3188 KO on HCC tumor growth and metastasis. ",
"Compared with the tumors derived from control cells, miR-3188 KO tumors presented the smaller average tumor size (0.43±0.15 *versus* 1.87±0.31; *P*\\<0.01) and less average number (6±2 *versus* 45.33±7.02; *P*\\<0.01; [Figure 4e](#fig4){ref-type=\"fig\"}). ",
"Consistent with the results above, hematoxylin and eosin staining revealed markedly reduced tumor size and number in tumors derived from miR-3188 KO cells ([Figure 4e](#fig4){ref-type=\"fig\"}). ",
"Taken together, miR-3188 KO suppressed HCC growth and metastasis *in vivo*, indicating that the roles of miR-3188 serve as a potential therapeutic target for HCC.",
"\n\nHBx promotes CREB-mediated activation of miR-3188 and downregulates ZHX2\n------------------------------------------------------------------------\n\nWe determined the expression of miR-3188, ZHX2, and HBx by qRT-PCR and western blot assays in HCC tissues, respectively. ",
"Our data indicated that HBx and miR-3188 expressions were upregulated and ZHX2 expression was downregulated in 150 HCC tissues, whereas HBV infection was strongly associated with miR-3188 (*R*^2^ =0.819, *P*\\<0.01) and ZHX2 expression (*R*^2^=0.703, *P*\\<0.01; [Figures 5a and b](#fig5){ref-type=\"fig\"}). ",
"Next, we found that the miR-3188 expression levels were significantly higher in liver tissues of 6-month-old HBV transgenic mice than in those of C57/BL6 mice (*P*\\<0.01; [Figure 5c](#fig5){ref-type=\"fig\"}). ",
"The miR-3188 expression was significantly higher in HepG2.215 cells than in HepG2 cells (*P*\\<0.01; [Figure 5d](#fig5){ref-type=\"fig\"}). ",
"Then, we transfected HepG2.215 cells with siHBx, causing the downregulation of miR-3188 expression, and the upregulation of ZHX2 expression (*P*\\<0.01; [Figure 5d](#fig5){ref-type=\"fig\"}). ",
"Furthermore, pcDNA 3.1-HBx was transfected into the HepG2 and SMMC7721 cells, subsequently upregulating miR-3188 expression in a dose-dependent manner (*P*\\<0.01; [Figure 5e](#fig5){ref-type=\"fig\"}). ",
"Taken together, our data suggested that HBx is able to upregulate miR-3188 in HCC.",
"\n\nIt has been reported that HBx is not able to bind directly to DNA, but it is suggested to interact with transcription factors, such as p53 and CREB, to regulate gene expression. ",
"Strikingly, we observed that putative CREB-binding sites were located in the miR-3188 upstream via Alggen Promo and JASPAR. ",
"Then, we applied siCREB to downregulate CREB in HepG2-HBx and SMMC7721-HBx cells that induced decrease in miR-3188 expression and increase in ZHX2 expression (*P*\\<0.01; [Figure 5f](#fig5){ref-type=\"fig\"}). ",
"In contrast, pcDNA 3.1-CREB was transfected into the cells that triggered increase in miR-3188 expression and decrease in ZHX2 expression (*P*\\<0.01; [Figure 5g](#fig5){ref-type=\"fig\"}). ",
"Furthermore, CREB stimulated the activity of the luciferase reporter gene containing the CREB-binding site, whereas CREB failed to activate the luciferase reporter gene containing mutant CREB-binding site or an upstream site without the CREB-binding site (*P*\\<0.01; [Figure 5h](#fig5){ref-type=\"fig\"}). ",
"To further determine the interaction of HBx with miR-3188 promoter, chromatin immunoprecipitation (ChIP) assay was performed. ",
"The results indicated that CREB was recruited to the miR-3188 promoter fragment, and HBx further increased the promoter occupancy of CREB (*P*\\<0.01; [Figure 5i](#fig5){ref-type=\"fig\"}). ",
"In summary, HBx promotes miR-3188 transcription by interacting with CREB.",
"\n\nMiR-3188 KO inactivated the HBx-mediated Notch signaling pathway through restoration of ZHX2\n--------------------------------------------------------------------------------------------\n\nTo further explore the mechanism of miR-3188 KO mediated antitumor effects on HCC, we identified potential downstream signaling pathways using western blot assay. ",
"We observed that the Notch signaling pathway was inactivated in miR-3188 KO clones and miR-3188 promoted the activation of Notch signaling pathway in HepG2 cells ([Supplementary Fig. ",
"2c](#sup1){ref-type=\"supplementary-material\"}). ",
"In addition, we found that inactivation of Notch signaling pathway induced by miR-3188 KO could be abolished through the inhibition of ZHX2 expression, and activation of Notch signaling pathway via miR-3188 could be suppressed by overexpression of ZHX2 ([Supplementary Figure 2c](#sup1){ref-type=\"supplementary-material\"}).",
"\n\nIt has been reported that Notch signaling was engaged in HBx-related HCC. ",
"We found that miR-3188 KO abolished the HBx-mediated activation of the Notch signaling pathway in HepG2 cells, and miR-3188 restored the activity of Notch signaling pathway in HepG2.215 cells treated with siHBx ([Supplementary Figure 2d](#sup1){ref-type=\"supplementary-material\"}). ",
"Furthermore, we transfected siZHX2 into the HepG2 cells, and the Notch signaling pathway was subsequently activated. ",
"Then, RO4929097 and *γ-*secretase inhibitor (DAPT) was used to block siHBx-induced activation of the Notch signaling pathway ([Supplementary Figure 2e](#sup1){ref-type=\"supplementary-material\"}). ",
"Our data suggested that miR-3188 KO abolished the HBx-induced activation of Notch signaling pathway through ZHX2.",
"\n\nZHX2 functions as transcriptional repressors of Notch1 via interacting with NF-YA\n---------------------------------------------------------------------------------\n\nIt has been reported that ZHX2 functions as a transcriptional repressor. ",
"We transfected BEL7402 cells with pcDNA3.1-ZHX2, causing the downregulation of Notch1 expression in a dose-dependent manner. ",
"Notch1 expression increased dose dependently when siZHX2 was transfected into HepG2 cells (*P*\\<0.01; [Figure 6a](#fig6){ref-type=\"fig\"}). ",
"It has been suggested that ZHX2 regulates Notch1 expression. ",
"To examine whether ZHX2 regulates Notch1 promoter activity, ZHX2 and wild-type promoter pGL3-Notch1 were co-transfected into BEL7402 cells, whereas siZHX2 and pGL3-Notch1 were co-transfected into HepG2 cells. ",
"Our data showed that ZHX2 reduced the relative luciferase activity of Notch1 dose dependently, whereas siZHX2 increased the relative luciferase activity of Notch1 dose dependently (*P*\\<0.01; [Figure 6b](#fig6){ref-type=\"fig\"}). ",
"This indicated that ZHX2 interacts with the Notch1 promoter.",
"\n\nInterestingly, putative NF-YA binding sites were located upstream from Notch1 via Alggen Promo and JASPAR. ",
"ZHX2 functions as a repressor by interacting with NF-YA in HepG2 cells. ",
"To examine whether ZHX2 regulates Notch1 promoter activity indirectly, ZHX2, NF-YA, and wild-type promoter pGL3-Notch1 were co-transfected into HepG2 cells. ",
"We observed that ZHX2 could reduce the luciferase activity of NF-YA binding to wild-type Notch1 promoter, indicating that ZHX2 regulates Notch1 promoter activity by interacting with NF-YA (*P*\\<0.01; [Figure 6c](#fig6){ref-type=\"fig\"}). ",
"ChIP assay showed that NF-YA was recruited to the Notch1 promoter fragment, and ZHX2 decreased the promoter occupancy of NF-YA (*P*\\<0.01; [Figure 6d](#fig6){ref-type=\"fig\"}). ",
"Taken together, ZHX2 represses Notch1 transcription by interacting with NF-YA.",
"\n\nDiscussion\n==========\n\nAccumulating evidence revealed that miRNAs are pivotal mediators of HBV infections, hepatocarcinogenesis, and progression.^[@bib14],\\ [@bib15]^ To our knowledge, the molecular details of HBV-related HCC patients with a family history of HCC are still largely elusive. ",
"In our previous study, through the comparison of miRNA expression profiles in the HBV-related HCC patients who had a family history of HCC with that in healthy volunteer, microarray results identified six miRNAs, miR-215, miR-3188, miR-374a, miR-215, miR-23b, miR-138-2\\*, and miR-216b, with over a 100-fold change in expression. ",
"Of the identified miRNAs, we focused on miR-3188 as its role has not been reported previously in HCC. ",
"Our data revealed that miR-3188 expression was markedly upregulated in HCC tissues compared with adjacent liver tissues and was significantly correlated with serum HBV DNA level, AFP expression, and prognosis after liver resection for HCC. ",
"Thus, the markedly overexpressed miR-3188 may play a pivotal role in the pathogenesis and progression of HCC.",
"\n\nCRISPR/Cas9 system is emerging as a state-of-art genome editing tool, and has a major impact on functional genetics in biological research.^[@bib16]^ It is a microbial adaptive immune system composed of cas9 endonuclease, a sgRNA, and a transactivating CRISPR RNA (tracrRNA) that conferring targeted gene editing by small RNAs that guide the Cas9 nuclease to cleave foreign genetic elements.^[@bib17]^ Recent studies reported that CRISPR/Cas9 could knock out miRNA expression more conveniently and efficiently.^[@bib18]^ We designed CRISPR/Cas9 to target the sequences adjacent to Drosha processing sites in the secondary stem-loop structure of miR-3188, using the methodology presented by Chang *et al.*^[@bib19]^ It has been reported that the inhibition of Drosha can lead to upregulation of primary miRNA (pri-miRNA) and in turn downregulation of mature miRNA.^[@bib20]^ As expected, the accumulation of pri-miR-3188 and the downregulation of miR-3188 was found in the CRISPR/cas9-transfected cells. ",
"Then, we detected that miR-3188 KO suppresses cell growth, migration, and invasion of HCC cells *in vitro* and inhibits tumor growth and metastasis *in vivo*. ",
"All the evidences revealed that oncogene miR-3188 emerged as a potential therapeutic target and may behave as a tumor marker for the early detection of HBV-related hepatocarcinogenesis with a family history of HCC.",
"\n\nHBV infection is a major risk factor for HCC. ",
"Increasing evidence indicates an important role of HBV, especially HBx, in modulating the expression of cellular miRNAs that likely contribute to the pathogenesis of HCC. ",
"Xu *et al.*^[@bib21]^ reported that HBx suppresses p53-mediated activation of miR-148a and activates mTOR signaling pathway through restoration of HPIP to enhance tumorigenesis. ",
"Wang *et al.*^[@bib22]^ found that HBx-mediated downregulation of let-7a and upregulation of STAT3 leads to hepatocarcinogenesis. ",
"We also demonstrated that HBx suppresses p53-mediated activation of miR-216b, promotes IGF2BP2, and activates downstream signaling pathways in our previous study.^[@bib13]^ In the present study, we found that overexpression of miR-3188 was positively correlated with serum HBV DNA level, and miR-3188 expression was also found upregulated in the liver tissues of HBV transgenic mice and HepG2.215 cells compared with C57BL/6 mice and HepG2 cells. ",
"Therefore, we further explored the underling mechanisms of HBV in regulating miR-3188 expression. ",
"We found that HBx was the key mediator of miR-3188 expression via transcriptional regulation. ",
"It has been reported that ectopic expression of HBx functions as a transactivating protein through interaction with transcription factors such as activating protein-1 (AP-1), NF-*κ*B, and CREB.^[@bib23]^ As expected, our data showed that HBx promotes miR-3188 expression via CREB-mediated activation.",
"\n\nComplicating the function of miRNAs in HBV-related HCC, it has been established that aberrantly expressed miRNAs can affect crucial signaling pathways. ",
"Our data demonstrated that miR-3188 KO can significantly inhibit the growth and metastasis of HCC cell lines *in vitro* and *in vivo* by inactivating Notch signaling pathways through upregulation of ZHX2. ",
"Mounting evidence confirmed that ZHX2 functions as a tumor suppressor and has been regarded as a transcriptional repressor negatively regulating the tumor markers AFP, GPC3, and H19.^[@bib24]^ Yue *et al.*^[@bib25]^ reported that ZHX2 could inhibit proliferation of HCC through transcriptionally regulating the expression of Cyclins A and E. Ma *et al.*^[@bib26]^ found that ZHX2 represses transcription of genes associated with HCC by interfering with NF-YA in liver tumor cells. ",
"It has been demonstrated that HBx activates Notch signaling in HCC by promoting miR-3188 and repressing ZHX2 as described above. ",
"Thus, we presumed that ZHX2 might repress the Notch1 expression and inactivate Notch signaling in HCC by interacting with NF-YA. ",
"Interestingly, we found that ZHX2 indeed repressed Notch1 transcription by interacting with NF-YA. ",
"Taken together, the data proved that HBx promotes CREB-mediated activation of miR-3188 and activates Notch signaling through repressing ZHX2. ",
"Kongkavitoon *et al.*^[@bib27]^ recently found that HBx activates Notch signaling via Delta-Like 4/Notch1 in HCC. ",
"However, the exact molecular mechanisms underlying Notch signaling functions and regulation need further investigation.",
"\n\nTo our knowledge, the HBx--miR-3188--ZHX2--Notch1 signaling pathway regulation axis ([Supplementary Figure 2f](#sup1){ref-type=\"supplementary-material\"}) was reported for the first time that may underlie the mechanisms of HBV-related HCC with a family history of HCC. ",
"MiR-3188 may be a useful diagnostic tool, a prognostic marker, and potential therapeutic target molecule that provides novel insights into HBV-related HCC. ",
"Further studies will be required to investigate whether detecting miR-3188 in plasma can be used to refine HCC surveillance guidelines based on the status of family history of HCC personalized for HBV patients.",
"\n\nMaterials and Methods\n=====================\n\nPatients and specimens\n----------------------\n\nA total of 150 pairs of human HCC tissues and their corresponding adjacent liver tissues (2 cm away from the tumor margin) were collected from patients who underwent liver resection between January 2007 and December 2008, and blood samples from 10 patients with HBV-related HCC and 10 healthy volunteers were collected between October and November 2015 at the Hepatic Surgery Center of Tongji Hospital affiliated with Huazhong University of Science and Technology (HUST). ",
"The follow-up was completed in December 2015. ",
"Written consent was obtained from all the patients and healthy volunteers before participating in the study. ",
"The study was approved by the medical ethics committee of Tongji Hospital, HUST, China.",
"\n\nCRISPR/Cas9 plasmid construction\n--------------------------------\n\nThe transfer plasmid lentiCRISPR v2 (\\#52961), packaging plasmids pCMV-VSV-G (\\#8454), and psPAX2 (\\#12260) was obtained from Addgene. ",
"The sgRNAs targeting hsa-miR-3188 were designed by CRISPR DESIGN (<http://crispr.mit.edu/>) that was developed by Dr. Feng Zhang's Lab at MIT. ",
"The sgRNA-miR-3188 sequence is 5′-TCCTGCTCTGCTGTGCCGCC-3′. Specific target sequences were amplified and subcloned into the lentiCRISPR v2 plasmid and verified by DNA sequence analysis. ",
"The lentiCRISPR v2 plasmid encoding a nonspecific 20 nt guide RNA was used as a negative control for CRISPR/Cas9 knockout plasmids.",
"\n\nT7EN1 analysis\n--------------\n\nHepG2 cells were transfected with lentiCRISPR v2 containing sgRNA that targets miR-3188 or control plasmid. ",
"The genomic DNA was isolated for PCR amplification. ",
"The amplified fragments were purified using Genomic DNA Purification Kit (Thermo Fisher Scientific, Waltham, MA, USA). ",
"After being denatured and reannealed, the PCR products were digested with T7 endonuclease I (NEB). ",
"Digested fragments were separated on a 2% agarose gel. ",
"Images were captured by ChemiDoc XRS (Bio-Rad, Hercules, CA, USA).",
"\n\nLuciferase reporter assay\n-------------------------\n\nTo verify the target sites of miRNAs, HepG2 and SMMC7721 cells were co-transfected with miR-3188 and luciferase reporter constructs containing wild-type or mutated ZHX2 3′-UTR. ",
"To study the effect of CREB on miR-3188 promoter activity, the plasmids containing fragments of human miR-3188 upstream region were respectively co-transfected with transfected with CREB or empty vector into HepG2 and SMMC7721 cells. ",
"To study the effect of NF-YA on Notch1 promoter activity, plasmids containing fragments of wild type or mutant NF-YA binding site were respectively co-transfected HepG2 cells with NF-YA, siZHX2, or empty vector into HepG2 cells. ",
"Cells were split and the activities were measured 24 h after transfection using Dual-Luciferase Assay Kit (Promega, Madison, WI, USA).",
"\n\nChIP assays\n-----------\n\nChIP assay was performed using Magna ChIP Assay Kit (Millipore, Billerica, MA, USA) according to the manufacturer's instructions. ",
"DNAs were coimmunoprecipitated with normal IgG, anti-CREB, or anti-NF-YA antibodies (Abcam, Cambridge, MA, USA) at 4 °C in a shaker overnight. ",
"MiR-3188 and Notch1 promoter was amplified by PCR using the primer pairs listed in [Supplementary Table 1](#sup1){ref-type=\"supplementary-material\"}.",
"\n\nStatistical analysis\n--------------------\n\nAll the results were expressed as mean±S.D Categorical variables were compared using the *χ*^2^ test, Fisher's exact test, or one-way ANOVA with *P*\\<0.05 considered statistically significant. ",
"OS was calculated by the Kaplan--Meier method and compared between the groups using the log-rank test. ",
"Multivariate analysis based on the proportional hazards model was used to identify the independent prognostic factors influencing OS. ",
"All the experimental data were analyzed using SPSS statistical software (version 16.0; SPSS Inc., Chicago, IL, USA).",
"\n\nWe thank all the authors for discussing the project. ",
"This work was supported by the National Natural Science Foundation of China (81202300 to Hui-Fang Liang).",
"\n\n**Author contributions**\n\nConception and design of the study: Fu-Yao Liu, Yue-Ling Deng, and Hui-Fang Liang; generation, collection, assembly, analysis, and/or interpretation of data: Fu-Yao Liu and Shao-Jun Zhou; drafting or revision of the manuscript: Fu-Yao Liu, Shao-Jun Zhou, and Jonathan C Jaoude; approval of the final version of the manuscript: all authors.",
"\n\n[Supplementary Information](#sup1){ref-type=\"supplementary-material\"} accompanies this paper on Cell Death and Differentiation website (http://www.nature.com/cdd)\n\nEdited by H-U Simon\n\nThe authors declare no conflict of interest.",
"\n\nSupplementary Material {#sup1}\n======================\n\n###### \n\nClick here for additional data file.",
"\n\n###### \n\nClick here for additional data file.",
"\n\n###### \n\nClick here for additional data file.",
"\n\n###### \n\nClick here for additional data file.",
"\n\n{#fig1}\n\n{#fig2}\n\n{#fig3}\n\n{#fig4}\n\n{#fig5}\n\n{#fig6}\n"
] |
{
"pile_set_name": "PubMed Central"
}
|
[
0.013215859030837005,
0.017721518987341773,
0.016574585635359115,
0.010723860589812333,
0.02304147465437788,
0.013888888888888888,
0.008298755186721992,
0.009950248756218905,
0.015384615384615385,
0.007159904534606206,
0.013986013986013986,
0.0051813471502590676,
0,
0.015228426395939087,
0.012244897959183673,
0.006329113924050633,
0.015503875968992248,
0.0058823529411764705,
0.014285714285714285,
0,
0.0058823529411764705,
0.012658227848101266,
0.012135922330097087,
0.009852216748768473,
0.008298755186721992,
0.011764705882352941,
0.005263157894736842,
0.022988505747126436,
0.007575757575757576,
0.013422818791946308,
0.0064516129032258064,
0.010810810810810811,
0.012987012987012988,
0.015503875968992248,
0.009569377990430622,
0.006535947712418301,
0.02857142857142857,
0.016194331983805668,
0,
0,
0.011627906976744186,
0.017857142857142856,
0,
0.008064516129032258,
0,
0.008733624454148471,
0.011494252873563218,
0.013245033112582781,
0.007462686567164179,
0.01910828025477707,
0.015432098765432098,
0.009615384615384616,
0.0037735849056603774,
0.01098901098901099,
0,
0.016129032258064516,
0.004291845493562232,
0,
0.022058823529411766,
0.003952569169960474,
0.010362694300518135,
0.018518518518518517,
0.014814814814814815,
0.009836065573770493,
0.014423076923076924,
0.0072992700729927005,
0.010582010582010581,
0.005,
0.024390243902439025,
0.005555555555555556,
0.016129032258064516,
0.00966183574879227,
0.0053475935828877,
0.01644736842105263,
0.007936507936507936,
0.016042780748663103,
0.0136986301369863,
0.008522727272727272,
0.01092896174863388,
0,
0.006191950464396285,
0.013157894736842105,
0.014184397163120567,
0,
0,
0.008849557522123894,
0.004166666666666667,
0.008,
0,
0.01639344262295082,
0.009569377990430622,
0,
0,
0.009174311926605505,
0.013888888888888888,
0.012738853503184714,
0.008438818565400843,
0.011363636363636364,
0.01282051282051282,
0.017064846416382253,
0.030303030303030304,
0.0196078431372549,
0.016666666666666666,
0.01834862385321101,
0.011940298507462687,
0.012578616352201259,
0.009345794392523364,
0.020833333333333332,
0.011695906432748537,
0.011235955056179775,
0.015384615384615385,
0.008948545861297539,
0.01020408163265306,
0.010638297872340425,
0.01,
0.006493506493506494,
0.00975609756097561,
0.018711018711018712,
0.015503875968992248,
0.015503875968992248,
0.010101010101010102,
0.014084507042253521,
0.02631578947368421,
0,
0.007407407407407408,
0.01282051282051282,
0.01904761904761905,
0.007067137809187279,
0,
0,
0.011494252873563218,
0.00980392156862745,
0.02097902097902098,
0.005405405405405406,
0.015267175572519083,
0.014184397163120567,
0.019230769230769232,
0.01680672268907563,
0.020202020202020204,
0,
0.015151515151515152,
0.004310344827586207,
0.017094017094017096,
0.004366812227074236,
0.029850746268656716,
0.006369426751592357,
0.006993006993006993,
0.013422818791946308,
0.008403361344537815,
0.009708737864077669,
0,
0.017241379310344827,
0,
0.01904761904761905,
0.010899182561307902,
0.012987012987012988,
0,
0,
0,
0,
0,
0.024,
0.015873015873015872,
0.011428571428571429,
0.013793103448275862,
0.009433962264150943,
0.00909090909090909,
0,
0.06060606060606061,
0.015789473684210527,
0.019417475728155338,
0,
0,
0.006493506493506494,
0,
0.013513513513513514,
0.010309278350515464,
0,
0,
0.005649717514124294,
0,
0,
0.0196078431372549,
0.010638297872340425,
0.012987012987012988,
0.020618556701030927,
0.008438818565400843,
0.0036363636363636364,
0.007407407407407408,
0.010282776349614395,
0,
0.008333333333333333,
0,
0,
0,
0.0053475935828877,
0,
0,
0.0196078431372549,
0.01818181818181818,
0,
0,
0,
0.006896551724137931,
0.004032258064516129,
0.009345794392523364,
0.004048582995951417,
0.020833333333333332,
0.0196078431372549,
0.025974025974025976,
0.009685230024213076,
0.006993006993006993,
0.007194244604316547,
0.012121212121212121,
0.011111111111111112,
0.0196078431372549,
0.00819672131147541,
0.01639344262295082,
0,
0.0196078431372549,
0.018518518518518517,
0.010362694300518135,
0.010752688172043012,
0.008403361344537815,
0,
0,
0.020833333333333332
] | 0.010296
| 5
|
[
"PS Medway Queen\n\nThe PS Medway Queen is a paddle driven steamship, the only mobile estuary paddle steamer left in the United Kingdom. ",
"She was one of the \"little ships of Dunkirk\", making a record 7 trips and rescuing 7000 men in the evacuation of Dunkirk.",
"\n\nShe was the subject of a £1.8 million National Lottery Heritage Memorial Fund grant to restore her hull. ",
"By 2014, her hull had been reconstructed and she is sitting at Gillingham Pier on the River Medway.",
"\n\nHistory\nPS Medway Queen was built at the Ailsa Shipbuilding Company in Troon, Scotland, in 1924 for service on the River Medway and in the Thames Estuary. ",
"Trialled on the River Clyde, she was delivered to be part of the \"Queen Line\" fleet of the New Medway Steam Packet Company based at Rochester, Kent. ",
"She steamed the Thames on the routes from Strood and Chatham, to Sheerness, Herne Bay and Margate in Kent; and Clacton and Southend in Essex.",
"\n\nOn 3 August 1929, Medway Queen collided with Southend Pier, Essex, and suffered extensive damage to her bows.",
"\n\nAfter attending the coronation Fleet Review for George VI at Spithead in 1937, Medway Queen was converted to oil-fired steaming, by Wallsend Slipway & Engineering Company in 1937.",
"\n\nWorld War II\nRequisitioned by the Royal Navy as a minesweeper, she was renumbered No J 48 (N 48), serving for the duration of World War II in the 10th minesweeping flotilla, protecting the English Channel.",
"\n\nHer first task in 1939 was evacuating Kent children from Gravesend to East Anglia. ",
"She was refitted in the shipyard of the General Steam Navigation Company (Deptford Creek), her aft being modified to take minesweeping gear. ",
"She operated patrolling the Straits of Dover. ",
"In May 1940 Operation Dynamo was launched to rescue the retreating British Army soldiers from Dunkirk in northern France. ",
"HMS Medway Queen became part of the flotilla of little ships. ",
" Medway Queen was fitted with a 12-pounder gun and two machine guns. ",
"She left with PS Sandown, PS Thames Queen, PS Gracie Fields, PS Queen of Thanet, PS Princess Elizabeth, PS Laguna Belle and PS Brighton Belle. ",
"She was to make seven crossings.",
"\n\nOn her first trip, soldiers were taken off the beaches in lifeboats and ferried to the ship. ",
"On her return to Dover, her arrival coincided with an air raid. ",
"She shot down a German aircraft outside the harbour. ",
"The Brighton Belle ran over sunken wreckage and began to sink. ",
"All of her passengers and crew were rescued by the Medway Queen without loss of life, and heavily overloaded she made the harbour.",
"\n\nOn her second trip she took the soldiers directly off the beach; this required more skill, but was much faster. ",
"Soldiers used a technique with oily bags to conceal their distinctive wash from patrolling aircraft. ",
"On later trips, the Medway Queen penetrated the damaged Dunkerque port and took off men from a concrete jetty or mole. ",
"Men were discharged at Ramsgate rather than Dover, where the vessel was re-oiled and reprovisioned.",
"\n\nOn Monday 3 June Vice Admiral Ramsey gave the order that all ships were to leave Dunkirk by 2.30 the following morning. ",
"This was the Medway Queens seventh trip. ",
"She was at the mole in Dunkirk when a destroyer moored astern of her was driven forwards by an explosion and smashed her starboard paddle box, she sustained considerable damage. ",
"Medway Queen limped back to Dover with 400 French soldiers on board. ",
"By then, she had rescued 7,000 men.",
"\n\nShe gained four awards for gallantry, having shot down three enemy aircraft, made seven crossings and rescued 7000 men. ",
" In view of this remarkable achievement in rescuing so many Allied troops from France, she earned the title of \"The Heroine of Dunkirk\". ",
"In 1942 she was converted to a mine sweeping training ship, and served out the war in this capacity.",
"\n\nReturn to service\nRebuilt by Thorneycrofts of Southampton in 1946, she returned to civilian service with New Medway Steam Packet Company for the 1947 season. ",
"When Elizabeth II was crowned, PS Medway Queen attended the 1953 Coronation Review at Spithead.",
"\n\nShe made her last sailing on 8 September 1963, and was scheduled to be scrapped in Belgium. ",
" The Belgian ship-breaker, upon discovering that the vessel he was expecting to break up was none other than \"The Heroine of Dunkirk\", declined to continue (it is reported that he felt that no one should dare to destroy such a gallant and important little ship). ",
"The Daily Mail newspaper campaigned to save her.",
"\n\nUse as nightclub\n\nHaving been saved from scrapping, Medway Queen was eventually sold for use as a nightclub and marina clubhouse, and was moored at the Medway Queen Marina (now known as the Island Harbour Marina) on the Isle of Wight. ",
"The club opened in 1966. ",
"In 1970, a larger ship, PS Ryde, renamed as Ryde Queen, joined Medway Queen at the marina site, also operating as a nightclub. ",
"The two premises operated alongside one another for a period, until the Medway Queen was eventually closed and fell into disrepair.",
"\n\nPreservation\n\nIn 1978 the Medway Queen was bought by private owners with the aim of preserving her. ",
"She was moved out of the marina to the adjacent River Medina, but sank in the river when the hull sprang a leak. ",
"There she remained, in a state of increasing deterioration, until in 1984 she was salvaged, moved to Cowes at the river’s mouth, and thence towed back to Chatham in Kent on a salvage barge. ",
"In 1985 the Medway Queen Preservation Society''' formed, with the intention of preserving the historic ship.",
"\n\nIn 1987 she was moved to Damhead Creek, Kingsnorth on the Hoo Peninsula, but the trust lacked funds to bring her back to service, and struggled to preserve the structure. ",
"After a series of near disasters, in 2006 the National Lottery Heritage Memorial Fund agreed a £1.8 million funding package to restore her structure, subject to the society raising £225,000. ",
"Having completed the fund raising, the trust was disappointed that neither the insurance company or marine engineers were confident that her hull was seaworthy and able of sustaining lifting on to a pontoon. ",
"In October 2006, the Trust agreed to the deconstruction of the hull, and salvageable pieces were moved to Gillingham Pier (and a National Lottery funded warehouse) in Chatham Dockyard, in preparation of the hull being professionally restored to seaworthy condition.",
"\n\nIn October 2008, the society signed a contract with David Abels Shipbuilders to restore the hull at the Albion Dry Dock in Bristol. ",
"This to be done using plate rivetting by a team of 10, and was envisaged to take two years. ",
"Work began in April 2009 and was due to be completed in the summer of 2010. ",
" On 27 July 2013 the ship was rededicated. ",
"Plans were to float her out of the Albion Dock during the summer of 2013 and tow her back to Gillingham for a reception on 2 November.",
"\n\nThe tow home to Gillingham using the tug Christine started from Bristol on 24 October 2013, but due to weather conditions they were held up at Avonmouth until 15 November when the wind abated sufficiently, and the tow around Land's End and through the English Channel could continue in safety.",
"\n\nAt around 3pm on Friday 15 November 2013 the Medway Queen departed Avonmouth towed by the tug Christine. ",
"Benefiting from the good weather the tow continued throughout the weekend with her arriving back on her home territory on the River Medway. ",
"Despite earlier delays in commencing the tow the weather remained kind to the 'Heroine of Dunkirk' as she made the entire journey around Lands End and along the South Coast of England in one go without the need to seek shelter along the way. ",
"The tug and tow finally arrived on the River Medway on Monday 18 November 2013. ",
"Due mainly to tidal restriction the Medway Queen was buoyed in Saltpan Reach until high tide the following day.",
"\n\nThe crowds were gathered, the TV crews were in position and around 1.30pm the Medway Queen was finally in sight as she made her final leg of her journey to her new home at Gillingham Pier. ",
"Under the guidance of tug master Alan Pratt the historic vessel was brought gently into the pier at high tide.",
"\n\nOfficial number and code letters\nOfficial Numbers were a forerunner to IMO Numbers.",
"Medway Queen had the UK Official Number 148361. ",
"She used the Code Letters GGNG from 1944.",
"\n\nTimeline\n1924 – built Troon, Scotland, by the Ailsa Yard for service on the River Medway and the Thames Estuary. ",
"Trialled on the River Clyde\n1925 – worked on River Medway and the Thames Estuary, part of the \"Queen Line\" fleet of the New Medway Steam Packet Company based at Rochester, Kent\n1937 – attended the Coronation Review for George VI at Spithead\n1938 – converted by Wallsend Engineering from coal to oil burning, by Wallsend Engineering\n1939 – carried children evacuated from Kent to East Anglia. ",
"Joined Royal Navy as minesweeper No J 48 (N 48), serving for the duration of the war in the 10th minesweeping flotilla in the English Channel\n1940 – became part of the flotilla of ships evacuating British Army soldiers from Dunkirk during Operation Dynamo. ",
"After making seven trips (the record number of crossings by any merchant navy ship involved in the evacuation), she rescued over 7,000 men, gaining for the ship's crew four awards for gallantry, and shot down three enemy aircraft. ",
"At one time during the evacuation she was overdue and was thought to have been lost with all hands and troops – but she eventually arrived back at Dover, ready to return to France for more troops. ",
"The sterling efforts of the ship and her crew earned the paddle steamer the title of \"Heroine of Dunkirk\"\n1946 – rebuilt by Thorneycrofts of Southampton\n1947 – returned to civilian service with New Medway Steam Packet Company\n1953 – attended the Coronation Review for Queen Elizabeth II at Spithead\n1963 – taken out of service, with the possibility of being broken up (but the Belgian shipbreaker declined to break up the \"Heroine of Dunkirk\", so she was thus saved an ignoble end)\n1964 – sold, and later opened as a nightclub on the Isle of Wight\n1970s – replaced by the larger PS Ryde'' and moved to the River Medina, but sank when the hull sprang a leak\n1984 – raised and towed back to the River Medway on a pontoon by new owners\n???? – ",
"abandoned and sank again, while moored against the wall of Chatham Dockyard\n1985 – the Medway Queen Preservation Society formed, with the intention of preserving the ship\n1987 – raised and moved to Damhead Creek, Kingsnorth on the Hoo Peninsula\n2006 – the National Lottery Heritage Memorial Fund agreed a £1.8 million funding package to restore the structure, subject to the Society raising £225,000\n2006 – deconstructed, as hull considered both unseaworthy and of sustaining lifting onto a pontoon. ",
"The hull and salvageable pieces were moved to Chatham Dockyard\n2009 – restoration began in April, with new hull to be constructed at Albion Shipyard, Bristol.",
"\n2011 – Visitors' Centre opened at Gillingham Pier, funded by the European Heroes2c project with sister projects Association Tourville and de Steenschuit\n2013 – new hull entered the River Medway at Sheerness under tow from Bristol on 18 November 2013\n\nReferences\nNotes\n\nBibliography\n\nExternal links\n\nMedway Queen Preservation Society\n\nCategory:Paddle steamers of the United Kingdom\nCategory:Ships built on the River Clyde\nCategory:1924 ships\nCategory:Merchant ships of the United Kingdom\nCategory:Minesweepers of the Royal Navy\nCategory:World War II minesweepers of the United Kingdom\nCategory:Museum ships in the United Kingdom\nCategory:Tourist attractions in Kent\nCategory:Little ships of Dunkirk\nCategory:Heroes2c\nCategory:Ships and vessels of the National Historic Fleet\nCategory:Maritime incidents in 1929"
] |
{
"pile_set_name": "Wikipedia (en)"
}
|
[
0.014925373134328358,
0.01652892561983471,
0.009345794392523364,
0,
0.012738853503184714,
0.006711409395973154,
0.028368794326241134,
0.02702702702702703,
0.027624309392265192,
0.004830917874396135,
0,
0.0070921985815602835,
0,
0.01639344262295082,
0,
0,
0.04895104895104895,
0,
0,
0,
0,
0.015873015873015872,
0,
0,
0,
0.008403361344537815,
0,
0.01639344262295082,
0.024390243902439025,
0.0056179775280898875,
0,
0,
0,
0.0072992700729927005,
0,
0.00625,
0.031578947368421054,
0,
0,
0.020833333333333332,
0.004219409282700422,
0,
0.023622047244094488,
0,
0,
0.008849557522123894,
0,
0,
0.005780346820809248,
0.005235602094240838,
0,
0.011320754716981131,
0.007462686567164179,
0,
0,
0,
0,
0.013559322033898305,
0.018691588785046728,
0,
0,
0.0125,
0,
0.005235602094240838,
0.00909090909090909,
0.011764705882352941,
0.020833333333333332,
0,
0.017391304347826087,
0.02040816326530612,
0.011673151750972763,
0,
0,
0.008108108108108109,
0.012,
0.0189873417721519,
0.012345679012345678
] | 0.008003
| 5
|
[
"As reported earlier, President Trump owned CNN’s Jim Acosta after the reporter asked why a press conference was not being held following the deadly Charlottesville protests. ",
"Acosta asked if he could ask him questions and the President zinged him! “",
"I like real news, not fake news – you’re fake news,” President Trump said.",
"\n\nAcosta thought he hit a home run when he quickly replied to the President’s humiliating zinger. ",
"He rattled off a low energy response and Trump supporters digitally destroyed him.",
"\n\nCNN’s Jim Acosta sent out a tweet after President Trump slammed him for being fake news. ",
"He said, “As the president was walking out, I responded that he has spread plenty of fake news himself.”",
"\n\nTRENDING: Black Lives Matter Activist Wearing 'Justice for Breonna Taylor' Shirt Walked into a Louisville Bar and Murdered Three People\n\nWOW so powerful!",
"\n\nAs the president was walking out, I responded that he has spread plenty of fake news himself. — ",
"Jim Acosta (@Acosta) August 14, 2017\n\nAnd the internet responded:\n\nWow, Jim. ",
"Your Cosmopolitan Style Journalism really let the @POTUS have it.",
"🙄 Just face it, you're no match. ",
"pic.twitter.com/UrAKLsY94h — S.L. Stiles🇺🇸Text Trump to 88022 (@StacyLStiles) August 14, 2017\n\nhttps://twitter.com/ofccadjust/status/897245244919566336\n\nDid he laugh in your face puppetboy? ",
"I would've. — ",
"I have Angels (@lmlastla) August 14, 2017\n\n@acosta you have zero credibility. ",
"Thanks for getting @realDonaldTrump more support every day w/ your biased spew. ",
"Ppl hate you, love Trump! — ",
"Tammy Geraldson (@TammyGeraldson) August 14, 2017\n\nhttps://twitter.com/FemalesForTrump/status/897237393790705664\n\nYou embarrass yourself with your grandstanding. ",
"I get that you are angling for your own show but it is embarrassing to watch. — ",
"Carmine Sabia (@CarmineSabia) August 15, 2017\n\nhttps://twitter.com/Cernovich/status/897205258807410689\n\nSomebody get this man the Medal of Honor https://t.co/tP1XbcFoJf pic.twitter.com/cdRfPwgqca — Harry Khachatrian (@Harry1T6) August 14, 2017"
] |
{
"pile_set_name": "OpenWebText2"
}
|
[
0.022988505747126436,
0.013513513513513514,
0.013513513513513514,
0,
0.012195121951219513,
0.03296703296703297,
0,
0.012903225806451613,
0,
0.03896103896103896,
0.015384615384615385,
0,
0.015789473684210527,
0,
0.02564102564102564,
0.0125,
0.03571428571428571,
0.018518518518518517,
0,
0.024691358024691357
] | 0.014764
| 5
|
[
"Systemic production of prostacyclin and thromboxane A2 does not correlate with patency of the ductus arteriosus in very low birth weight infants.",
"\nUrinary excretion of prostacyclin and thromboxane metabolites (2,3-dinor-6-ketoprostaglandin F1 alpha, thromboxane B2, and 2,3-dinor-thromboxane B2) as indices of systemic biosynthesis was prospectively determined in nine premature infants during the first 10 days of life, by gas chromatography-mass spectrometry. ",
"The patients ranged in gestational age from 27 to 29 weeks and in birth weight from 720 to 980 gm. ",
"Four infants developed symptomatic patent ductus arteriosus (PDA). ",
"Excretion of all metabolites exceeded adult values on the basis of body surface area at birth, reached a maximum on the fourth day of life, was related to urine output, and did not distinguish patients with and without symptomatic PDA. ",
"We conclude that neither circulating prostacyclin nor thromboxane A2 contribute significantly to the pathophysiology of symptomatic PDA in very low birth weight infants."
] |
{
"pile_set_name": "PubMed Abstracts"
}
|
[
0,
0,
0,
0,
0,
0
] | 0
| 5
|
[
"then i have to start iceweasel first then i have to close iceweasel and then click on swiftfox to fire it up\n\nany suggestion splease to rectify this error\n\ndevil\n\nPost subject: RE: swiftfox not working Posted: 29.01.2011, 07:35\n\nJoined: 2010-08-26\nPosts: 491\nLocation: Berlin\nStatus: Offline\n\nwhat does console say when you start swiftfox\n\ngreetz\ndevil\n\nankscorek\n\nPost subject:Posted: 29.01.2011, 07:37\n\nJoined: 2010-09-29\nPosts: 40\n\nStatus: Offline\n\nit says nothing\n\nCode:\n\nskal@siduxbox:~$ swiftfox\nskal@siduxbox:~$\n\nbelze\n\nPost subject:Posted: 30.01.2011, 00:06\n\nJoined: 2010-09-13\nPosts: 100\n\nStatus: Offline\n\nuse iceweasel instead\n\nankscorek\n\nPost subject:Posted: 01.02.2011, 05:50\n\nJoined: 2010-09-29\nPosts: 40\n\nStatus: Offline\n\nthere are certain addons which are not compatible with iceweasel..so i have to switch to swiftfox\n\nslam\n\nPost subject:Posted: 01.02.2011, 11:07\n\nTeam Member\n\nJoined: 1970-01-01\nPosts: 607\nLocation: w3\nStatus: Offline\n\nSwiftfox is not maintained in Debian, and not compatible with existing Iceweasel or Firefox profiles. ",
"It is also not supported in Aptosid for the very same reason. ",
"If you really think you \"need\" it, use it inside a chroot or a virtual machine, which avoids interferences with Iceweasel and other Mozilla products.",
"\n\nI am not aware of any addons not working with Iceweasel, actually I cannot imagine any technical reasons for such problems. ",
"Swiftfox after all is nothing else than a simple Firefox re-build with some minor optimizations for newer hardware and re-branding.",
"\n\nI do not like to continue this, so this is my last post about this subject.",
"\n\nankscorek has 14 posts here. ",
"He may be used from other forums where such \"stupid\" questions are absolutely valid.",
"\n\nThere are more than one ways to do something and there are more than two ways to say something. ",
"One way is better and yours was not\n\nRegards\nsnvv\n\nslam\n\nPost subject:Posted: 06.02.2011, 14:19\n\nTeam Member\n\nJoined: 1970-01-01\nPosts: 607\nLocation: w3\nStatus: Offline\n\nThere are different ways to express yourself, there are different ways to tell people that they are obviously wrong, and there are different ways to deal with personal critics. ",
"Our forums is is not the place to tell others \"to use their brain\", and also not the place to educate those who did say so. ",
"I am closing this topic because the initial question is answered.",
"\nGreetings,\nChris"
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0,
0,
0.006711409395973154,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0.058823529411764705
] | 0.005041
| 5
|
[
"Another exciting ski jumping season is already a history so it is the time for all kinds of summaries. ",
"For the nearest weeks, our portal will concentrate on statistics concerning the last season. ",
"We’d like to start with well-known Ranking of Luck.",
"\n\nA quick reminder: Ranking of Luck is strictly linked to wind points deduction participants receive. ",
"The average number of points added or substracted has been computed for every round of the competition (individual and team competition of World Cup and World Championships). ",
"Then, the difference between a point compensation and the average has been computed for a given round. ",
"If the point compensation was higher than the average (which means better conditions), a participant was given negative points. ",
"Analogically, if the point compensation was lower (worse conditions), positive points were granted.",
"\n\nSuddenly, it turned out that the greatest luck to conditions had… Casey Larson. ",
"Individually, this 18-year-old American performed only in Trondheim and Lahti’s Men Large Hill Competition, but he was a member of team USA in a few team competitions. ",
"Surprisingly, after 7 jumps given, Larson had better conditions than an average of a round in 6 cases. ",
"The bulk of points received by American was in the team competition in Vikersund, when Larson had excellent conditions during his jump. ",
"By the way, Larson did in these conditions really well as he set his new personal best on 216.5 m.\n\nThe second place went to Lukas Hlava, who regularly had better conditions during the first part of the season. ",
"Czech was the most fortunate during the first competition in Lillehammer and in Innsbruck. ",
"Throughout his feeble season, those were the best competitions for him.",
"\n\nThe third most lucky of the season was Stephan Leyhe but, in his case, the result does not mix with his accomplishments. ",
"In the most important moment of the season, which was the World Ski Championships in Lahti, poor conditions during Leyhe’s jump took away a medal for the whole team. ",
"Besides this instance, the Germans were feeling lucky in the course of the season, including the competition in Pyongchang where advantageous conditions let Leyhe take the highest position in the season, 5th place.",
"\n\n“Lucky men” ranking of the 2016/2017 season:\n\nNo. ",
"Jumper Nation Pts 1 LARSON Casey -29.6 2 HLAVA Lukas -29.2 3 LEYHE Stephan -27.1 4 STJERNEN Andreas -26.7 5 KASAI Noriaki -23.5 6 KORNILOV Denis -23 7 SAKUYAMA Kento -21.8 8 JANDA Jakub -19.3 8 GRANERUD Halvor Egner -19.3 10 BAZHENOV Aleksandr -19.2 11 EISENBICHLER Markus -16.6 11 DELLASEGA Roberto -16.6 13 KRAFT Stefan -16.2 14 SEMENIC Anze -15.9 14 JOHANSSON Robert -15.9 16 KOUDELKA Roman -14.8 17 ITO Daiki -13 18 NOUSIAINEN Eetu -11.4 19 TOLLiNGER Elias -11.3 20 ZOGRAFSKI Vladimir -11.1 21 HAYBOECK Michael -10.8 22 KLIMOV Evgeniy -10.6 22 PASCHKE Pius -10.6 24 TROFIMOV Roman Sergeevich -10.2 25 PAVLOVCIC Bor -9.3 26 INSAM Alex -8.3 27 KOT Maciej -7.8 28 VASSILIEV Dimitry -7.4 29 STURSA Vojtech -6.5 30 NAZAROV Mikhail -6.4 31 SCHIFFNER Markus -6.1 32 BOYD-CLOWES Mackenzie -5.8 32 TKACHENKO Sergey -5.8 34 IWASA Yuken -5.7 35 DESCHWANDEN Gregor -4.6 36 SATO Yukiya -4.5 37 AALTO Antti -4.3 38 AIGNER Clemens -4.1 39 TANDE Daniel Andre -4 39 ALTENBURGER Florian -4 41 SCHULER Andreas -3.8 42 MURANKA Klemens -3.6 42 HUBER Daniel -3.6 44 POLASEK Viktor -3.4 45 HUBER Stefan -3 45 OSTERC Aljaz -3 47 BARTOL Tilen -2.9 47 WELLINGER Andreas -2.9 49 SIEGEL David -2.8 50 ROMASHOV Alexey -2.7 51 SCHLIERENZAUER Gregor -2.6 52 BRASME Paul -2.2 53 AHONEN Janne -1.8 54 NOMME Martti -1.5 54 NOGIN Roman -1.5 56 KOBAYASHI Ryoyu -1.3 57 ITO Masamitsu -1.2 58 KARPENKO Nikolay -0.7 58 HVALA Jaka -0.7 60 DEZMAN Nejc -0.6 60 SCHMID Constantin -0.6 62 LARINTO Ville -0.4 63 FREUND Severin -0.3\n\nAnze Lanisek turned out to be the most most unlucky person of the season. ",
"Slovenian, despite that one case in Korea when he was 4th, was unlucky throughout the season. ",
"The biggest bad luck happened to him during the team competition in Vikersund when he had terrible conditions in the first round. ",
"Additionally, he didn’t have luck during the skiflying event in Oberstdorf and competitions in Japan.",
"\n\nThe second place was taken by Manuel Fettner who was the most unlucky out of top 10 competitors. ",
"The long list of unfortunate competition includes: the second competition in Lillehammer, Innsbruck, Bischofshofen, both competitions in Wisla or the second competition in Sapporo. ",
"Perhaps, if it wasn’t for the bad conditions, Fettner would have been able to collect more points in the best season of his career.",
"\n\nTomas Vancura was classified on the lowest step of the podium. ",
"The 20-year-old was the most unlucky during the first ski flying event in Oberstdorf – negative rate of wind factor from two jumps combined stood for more than half of his score. ",
"The team event wasn’t the best either for Tomas.",
"\n\n“Unlucky men” ranking of the 2016/2017 season:\n\nNo. ",
"Jumper Nation Pts 1 LANISEK Anze 57.1 2 FETTNER Manuel 49 3 VANCURA Tomas 42.9 4 TEPES Jurij 36.7 5 PREVC Cene 32.4 6 DAMJAN Jernej 27.5 7 NURMSALU Kaarel 20 8 BICKNER Kevin 17.6 9 GLASDER Michael 17 10 STOCH Kamil 16.7 11 ZHAPAROV Marat 16.6 12 RHOADS William 16.3 13 GEIGER Karl 14.3 14 MATURA Jan 13.5 15 DESCOMBES SEVOIE Vincent 12.7 16 PEIER Killian 12.6 17 TAKEUCHI Taku 12.4 18 WANK Andreas 12 19 AUNE Joakim 11.8 20 ZIOBRO Jan 10.9 21 ASCHENWALD Phillip 10.7 22 KOFLER Andreas 10.5 23 FREITAG Richard 9.7 24 PREVC Peter 9.5 25 MAEAETTAE Jarkko 7.9 26 KARLEN Gabriel 7.8 27 COLLOREDO Sebastian 7.3 28 HULA Stefan 7.1 29 FORFANG Johann Andre 7 30 ZYLA Piotr 6.6 31 AMMANN Simon 6.5 32 CHOI Seou 6.3 33 NAKAMURA Naoki 4.8 34 ASIKAINEN Lauri 3.9 35 BRESADOLA Davide 3.5 36 ZNISZCZOL Aleksander 3.1 37 KOBAYASHI Junshiro 2.8 38 HAZETDINOV Ilmir 2 39 KUBACKI Dawid 1.7 40 HILDE Tom 1.1 41 HAUER Joachim 0.9 42 KIM Hyun-Ki 0.7 42 LAMY CHAPPUIS Ronan 0.7 44 FANNEMEL Anders 0.6 45 PREVC Domen 0.5 46 WOLNY Jakub 0.4 47 SOKOLENKO Konstantin 0.1 47 MUMINOV Sabirzhan 0.1 47 KOROLEV Alexey 0.1 47 KRATOV Ilya 0.1 47 BJOERENG Joacim Oedegaard 0.1 47 HOFER Thomas 0.1\n\nWhen it comes to nations, Russians were the luckiest while Slovenians and Poles were the least fortunate. ",
"It has to be stated that 35.1 points is not that much concerning the fact that 6 Polish jumpers were regularly participating in competitions. ",
"By contrast, Slovenians might have missed their countryman as the one who turns on the green light. ",
"However, we can’t accuse Borek Sedlak of being mean – Czech was great in his new role this season.",
"\n\nNations ranking of Luck of the 2016/2017 season:\n\nNo. ",
"Jumper Nation Pts 1 Russia -77.5 2 Japan -51 3 Norwey -44.4 4 Germany -24.9 5 Czech Republic -16.8 6 Italy -14.1 7 Bulgaria -11.1 8 Finland -6.1 9 Canada -5.8 10 Korea 7 11 Austria 8.6 12 Kazakhstan 9 13 France 11.2 14 Switzerland 18.5 14 Estonia 18.5 16 United States 21.3 17 Poland 35.1 18 Slovenia 131.3\n\nThe day after tomorrow we will handle the conversion rate for wind more precisely, but tomorrow the second part of the summary is coming in which we will take into consideration how the HS bareer was broken in particular competitions.",
"\n\nAuthor: Radosław Sarnik\n\nSource: own information + FIS"
] |
{
"pile_set_name": "OpenWebText2"
}
|
[
0,
0,
0,
0.00980392156862745,
0,
0,
0,
0.010101010101010102,
0.012195121951219513,
0,
0.009708737864077669,
0.007352941176470588,
0.009478672985781991,
0.01098901098901099,
0,
0.008130081300813009,
0.006024096385542169,
0.004672897196261682,
0,
0.008301404853128991,
0,
0,
0.009900990099009901,
0.010101010101010102,
0.016574585635359115,
0.007633587786259542,
0,
0.00558659217877095,
0.020833333333333332,
0,
0.01653543307086614,
0,
0,
0.01020408163265306,
0,
0.0036900369003690036,
0
] | 0.005346
| 5
|
[
"Packet based enterprise network services are complex and engineering centric to design. ",
"In most cases the service must connect many disparate customer locations in different geographic places, joining them all centrally using network resources from a core network. ",
"In some cases connectivity to a specific customer location may be provided by another communication service provider (CSP). ",
"In almost all cases the design of these services today is a manual exercise, supported with a master spreadsheet to track design progress, and is done on a location by location basis over a time period of one to six months, depending on the complexity of the network service. ",
"As these services become more of an expected commodity in the industry there is a move to partially automate the design and fulfillment of these services.",
"\nTo date, there is not an agnostic, technology independent “click-and-go” approach for network service design, configuration, and/or packet connectivity for all major packet based domains. ",
"Technology independent models are desired for supporting packet flow inspection, shaping, and configuration at any access point in a packet based network. ",
"In addition to this, systems and methods for at least partially automated visual design support and/or adequate modeling for complex multipoint-to-multipoint (MP2MP) services for all major packet based domains do not currently exist.",
"\nAs a result, a need exists for improved methods, systems, and computer readable media for configuring service networks for agnostic, technology independent modeling of network services, in at least a partially automated manner, having improved efficiency, speed, visual accessibility, ease of use, and reduced design error."
] |
{
"pile_set_name": "USPTO Backgrounds"
}
|
[
0,
0,
0,
0,
0,
0,
0,
0,
0
] | 0
| 5
|
[
"Hastening the enamel microabrasion procedure eliminating defects, cutting treatment time.",
"\nTwo cases illustrate the technique of treating enamel discoloration and decalcification by beginning with bur cutting and completing with microabrasion compound. ",
"This eliminates texture defects caused by bur cutting and reduces treatment time."
] |
{
"pile_set_name": "PubMed Abstracts"
}
|
[
0,
0,
0
] | 0
| 5
|
[
"###### Key questions\n\nWhat is already known about this subject?",
"\n=========================================\n\n- There is a burgeoning literature on valve clinics, but very little data on their financial implications for the healthcare system. ",
"No clear conclusions about their impact on hospital finances can be drawn from the available literature.",
"\n\nWhat does this study add?",
"\n=========================\n\n- In an age of austerity, this study looks at the impact of opening a valve clinic on the finances of a real-world department of cardiology, by modelling patient throughput as well as costs and savings.",
"\n\nHow might this impact on clinical practice?",
"\n===========================================\n\n- This paper is the starting point for a debate in the valve community regarding the practicalities and the financial implications of switching from the current model of care to a valve clinic-based one. ",
"The costing tool can be obtained from the authors and adapted for use in any clinical setting where valve clinics are operating or are being planned.",
"\n\nIntroduction {#s1}\n============\n\nThe incidence of degenerative valve disease is increasing as our populations age.[@R1] The population prevalence is about 2.5%, but may be as high as 13% in those aged 75 and older.[@R2] It is well recognised that the organisation of clinical care is suboptimal[@R3] with wide variations in access to appropriate medical care and surgery. ",
"Specialist multidisciplinary clinics are seen as best practice[@R4] [@R5] with a hub in 'surgical centres of excellence'[@R6] [@R7] and spokes in district hospitals or the community. ",
"However, the uptake of such clinics is incomplete, 21% in the UK.[@R8] The UK has developed devolved surveillance in which senior nurses or sonographers monitor patients with uncomplicated valve disease before and after surgery ([table 1](#OPENHRT2015000275TB1){ref-type=\"table\"}). ",
"One obstacle in developing such services is the lack of cost-effectiveness analyses. ",
"Here, we estimate the cost-saving likely from a multidisciplinary model run jointly by a cardiologist, sonographer and nurse. ",
"This may provide an aid to developing a business case for a clinic.",
"\n\n###### \n\nSummary of roles in the valve clinic\n\n Role Staff\n -------------------------------------------------------------------------------- --------------------------------\n New visits. ",
"Referral for surgery if necessary Cardiologist\n Assessment of follow-up patient with alerts. ",
"Referral for surgery as necessary Cardiologist\n Follow-up history Nurse/sonographer\n Performing exercise test Exercise physiologist\n Supervision of exercise test Nurse/sonographer/cardiologist\n Echocardiogram Sonographer/cardiologist\n Brain natriuretic peptide test Nurse/cardiologist/sonographer\n\nMethods {#s2}\n=======\n\nStaff levels {#s2a}\n------------\n\nWe estimated differences in cost of a standard model in which the cardiologist sees every case and two models for a multidisciplinary clinic in which some cases are devolved to sonographer-led or nurse-led clinics ([table 2](#OPENHRT2015000275TB2){ref-type=\"table\"}).",
"\n\n###### \n\nAssumptions regarding proportion of patients undergoing different tests and requiring consultant review in each of the models\n\n New cases (N=100) \n ------------------- ----- -----\n See cardiologists 100 100\n Have echo 100 100\n Have ETT 5 50\n See other staff 0 0\n\n Old model New models \n ---------------------------------------------------------------------------------- ----------- ------------ ----\n Follow-up cases (N=100 for each category, ie, native and operated valve disease) \n See cardiologists 100 25 25\n See nurse 0 0 75\n See sonographer 0 75 0\n Have echo 100 25 25\n Have ETT 5 5 5\n\n Operated valve disease (N=100) Consultant-led Sonographer only Sonographer and nurse\n -------------------------------- ---------------- ------------------ -----------------------\n See surgeon/cardiologist 100 10 10\n See nurse 0 0 90\n See sonographer 0 90 0\n Have echo 100 25 25\n Have ETT 5 5 5\n\nIn all models, we assumed that two administrative and clerical staff would be used, and we included costs for two healthcare support workers in the consultant-led, conventional model, to reflect current realities in UK clinics.",
"\n\nFor each of the models, we assessed the costs for seeing the following categories of patients: New patients, who all need to be seen by the consultant, as in the current 'conventional' model, but we specified that instead of the 5% who currently have exercise tests, a much higher proportion (50%) should have exercise tolerance tests (ETTs);Follow-up patients with native valve pathologies;Follow-up patients with operated valves.",
"\n\nIn groups (B) and (C), we devolved a substantial proportion of patients to follow-up by non-medical staff. ",
"We specified that a lower proportion (10%) of patients in group (C) would need to see the cardiologist than in group (B)---25%, as the valve operation generally removes the risk of progression of valve pathology, and we assumed that 5% of all patients being followed up would need ETT during follow-up in order to assess objectively any new symptoms that may have developed during follow-up.",
"\n\nWe used standard national tariffs for costing the echocardiograms and the exercise tests, and top of the scale figures for the salaries of the various staff categories involved. ",
"We specified a senior (band 8) sonographer for the sonographer-led clinic, and a senior nurse (band 8) working with a band 6 sonographer for the nurse-led clinic.",
"\n\nFinal cumulative costs are given in GB£ and in US\\$, rounded to the nearest decimal. ",
"The main savings are expected to be the cost of cardiologist time and in reducing unnecessary echocardiograms.[@R9]\n\nTaggu *et al*[@R9] showed that physician visits fell by 97%, from 998 to 31 in a year. ",
"However, 5% of patients from the surveillance clinics need to be seen by the cardiologist because of a new symptom or change in echo,[@R10] although the cardiology time needed is usually less than for a full visit as a result of the prior assessment by the sonographer or nurse. ",
"A further 10% require brief discussion by the sonographer or nurse with the cardiologist. ",
"A proportion of patients require follow-up with the cardiologist because of complex disease or proximity to thresholds for surgery.[@R11]\n\nEchocardiograms {#s2b}\n---------------\n\nCompliance with guidelines is patchy and echocardiograms tend to be performed unnecessarily[@R12] particularly after valve replacement. ",
"In some centres,[@R9] all replacement valves are examined annually. ",
"We modelled the cost of an echocardiogram at £74 (\\$117) which is the National Health Service (NHS) tariff, and we assumed that 100% of patients would have echos in the conventional model compared with 25% of those seen in a valve clinic.",
"\n\nOther tests {#s2c}\n-----------\n\nExercise test are underutilised and requested in only about 10% of those in whom it would be indicated.[@R15] This means that allowing 100 new patients of whom 50 might have asymptomatic severe disease, 5 tests might be performed using the conventional model and 50 using the new model. ",
"We assumed the cost of an ETT to be £60 (\\$94), according to the NHS tariff. ",
"Numbers of chest X-ray, brain natriuretic peptide (BNP) estimation, Holter, CT were assumed to be similar in all groups and were therefore not included in the analysis.",
"\n\nAll costs are expressed per 100 patients seen in the clinic.",
"\n\nAutomated costing tool {#s2d}\n----------------------\n\nWe collated all the above information using a custom-made Excel table (MS Office, 2007) with input cells corresponding to costs for individual components of each of the clinic configurations described, and with output cells configured to yield total costs in the various permutations of staff, access to tests and time needed to complete a consultation described above. ",
"The costing tool is available from the authors. ",
"Figures can be entered in the source cells, and the destination cells will update the costs accordingly ([tables 3](#OPENHRT2015000275TB3){ref-type=\"table\"}--[](#OPENHRT2015000275TB4){ref-type=\"table\"}[](#OPENHRT2015000275TB5){ref-type=\"table\"}[](#OPENHRT2015000275TB6){ref-type=\"table\"}[7](#OPENHRT2015000275TB7){ref-type=\"table\"}).",
"\n\n###### \n\nStaff-related costs for *one follow-up consultation* in the valve clinic, in each of the three models\n\n Staff involved Gross cost Cost/productive hour Consultant Senior sonographer Sonographer and staff nurse \n --------------------- ------------ ---------------------- ------------ -------------------- ----------------------------- -------- ------------ -------\n 0.25 h 0.75 h 0.75 h \n WTE needed WTE needed WTE needed \n Band 6 sonographer 44 570 26 1 19.38\n Band 8a nurse 60 780 35 1 26.43\n Band 8b sonographer 72 934 42 1 31.71 \n Consultant 120 000 109 1 27.21 \n A&C 2 22 492 13 2 6.52 2 19.56 2 19.56\n HCSW 2 22 492 13 1 3.26 \n SpR 57 751 37 1 9.17 \n Consultation cost 46.16 51.27 65.36\n\nWe allocated 15 min of consultant time and 45 min of non-consultant staff time per patient, expressed staff requirements as WTE and specified two healthcare assistants only for the consultant-led clinic, but clerical support for all. ",
"These time-indexed costs are used to calculate follow-up costs/100 patients with native or operated valve disease. ",
"The differences in the cost of valve clinic follow-up for patients with native versus operated valves arise from the different proportions assumed to need consultant review.",
"\n\nA&C, admin and clerical staff; HCSW, healthcare support worker; SpR, specialist registrar (cost does not include banding); WTE, working time equivalent.",
"\n\n###### \n\nCosts of seeing *new patients* in the conventional as opposed to the dedicated valve clinic\n\n Conventional model Valve clinic model \n ---------------- -------------------- -------------------- -------- -----------\n Consultant-led 100.00 9231.34 100.00 9231.34\n Refer for echo 100 7400 100 7400\n Refer for ETT 5 300 50 3000\n Total cost 16 931.34 19 631.34\n\nThere is a 10-fold increase in the utilisation of ETT in the valve clinic, and the time allocated to the consultant for one consultation is 30 min as opposed to 15 min in the follow-up configuration.",
"\n\n###### \n\nTotal costs incurred for seeing *100 follow-up patients with native valve disease* in each of the models\n\n Model 1---consultant-led Model 2---senior sonographer Model 3---sonographer and nurse \n ------------------- -------------------------- ------------------------------ --------------------------------- --------- ---- ---------\n S/B consultant 100 4615.67 25 1153.92 25 1153.92\n S/B other staff 0 0 75 3845.14 75 4902.18\n Referred for echo 100 7400 25 1850 25 1850\n Referred for ETT 5 300 5 300 5 300\n Total cost 12 315.67 7149.06 8206.10\n\nETT, exercise tolerance test; S/B, seen by.",
"\n\n###### \n\nTotal costs incurred for seeing *100 follow-up patients with operated valve disease* in each of the models\n\n Model 1---consultant-led Model 2---senior sonographer Model 3---sonographer and nurse \n ----------------- -------------------------- ------------------------------ --------------------------------- --------- ------- ---------\n S/B consultant 100.00 4615.67 10.00 461.57 10.00 461.57\n S/B other staff 0 0 90.00 4614.16 90.00 5882.61\n Refer for echo 100 7400 25 1850 25 1850\n Refer for ETT 5 300 5 300 5 300\n Total cost 12 315.67 7225.73 8494.18\n\nETT, exercise tolerance test; S/B, seen by.",
"\n\n###### \n\nSummary of costs\n\n Conventional model Valve clinic model 1 Valve clinic model 2\n -------------------------- -------------------------- -------------------------- ------------------------\n New patients £16 811.34 (\\$26 472.82) £19 631.34 (\\$18 838.47) NA\n Native valve follow-up £12 315.67 (\\$19 393.49) £7149.05 (\\$11 257.61) £9020.10 (\\$14 203.95)\n Operated valve follow-up £12 315.67 (\\$19 393.49) £7225.73 (\\$11 378.36) £9308.18 (\\$14 657.60)\n\nFor new patients just one valve clinic configuration is considered (see text for explanation).",
"\n\nNA, not available.",
"\n\nResults {#s3}\n=======\n\nNew patients {#s3a}\n------------\n\nWe found that the costs for seeing new patients were £16 811.34 (\\$26 472.82) in the conventional model and £19 631.34 (\\$18 838.47) in the valve clinic model (both consultant-led). ",
"The increase in cost was due entirely to the 10-fold increase in the proportion of patients referred to have exercise tests, in compliance with current guidelines.",
"\n\nFollow-up: native valve disease {#s3b}\n-------------------------------\n\nThe lowest cost was achieved in the sonographer-led clinic (£7149.06, \\$11 257.61) and the highest in the consultant-led clinic (£12 315.67, \\$19 393.49), with the nurse-led clinic in an intermediate position (£8206.10, \\$12 922.14).",
"\n\nFollow-up: operated valve disease {#s3c}\n---------------------------------\n\nThe same relative magnitude of costs was observed for postsurgical patients: To follow-up 100 such patients, the hospital would spend £7.225.73, \\$11 378.36 in the sonographer-led clinic; £12 315.67, \\$19 393.49 in the consultant-led clinic; and £8494.18, \\$13 375.73 in the nurse-led clinic.",
"\n\nDiscussion {#s4}\n==========\n\nThis work shows that a multidisciplinary clinic is expected to save substantial sums. ",
"There is little previously published work. ",
"Extrapolating from the practice of one district general hospital gave an estimated yearly excess expenditure on unjustified echocardiograms in the UK of £4.6 million (£3 253 087; \\$5 122 636).[@R12] Turpie *et al*[@R13] estimated that a surveillance clinic for aortic stenosis alone would achieve recurring savings in the UK amounting to \\>9000 avoided transthoracic echocardiographys (TTEs)/year suggesting a saving of some £2 million (\\$3.14 million) if all types of valve disease are included. ",
"In the first study of this kind performed outside the USA, a survey of all the hospitals which perform echocardiography in Wales[@R14] found that 11% of scans were requested for inappropriate indications, with 'routine' follow-up scans after valve replacement, a common reason for unnecessary studies.",
"\n\nOther potential savings {#s4a}\n-----------------------\n\nIn a Canadian study,[@R16] the rate of adherence to American Heart Association (AHA) guidelines varied between only 2% and 30%, and adherence is also limited in the USA,[@R17] Europe[@R15] and the UK.[@R9] This means that surgery occurs late usually with class III or IV symptoms leading to prolonged intensive treatment unit and hospital stays, and very high costs incurred by the NHS along their care pathway. ",
"Specialist valve clinics detect symptoms earlier[@R3] and have the potential to reduce costs drastically in this patient population by allowing timely referral for treatment.",
"\n\nThere would be savings from lesser utilisation of hospital transport (average cost £20 (\\$32) per journey) for the patient savings on car parking, days off work, time waiting to be seen. ",
"Imponderable savings include less easily quantifiable financial implications of valve clinics: Ensuring that patients who have valves suitable for mitral repair are referred to surgeons able to perform repairs (this would increase the rate of mitral valve repair, currently rather low at 67% in the UK,[@R18] and would avoid need for prolonged anticoagulation, with its associated morbidity and costs).Better dental surveillance with prevention of infective endocarditis (with the attending savings from avoiding very expensive and prolonged hospital admissions);Improved anticoagulation control. ",
"Less time off work and a shift of the care model towards keeping patients out of hospital.",
"\n\nPotential causes of higher costs {#s4b}\n--------------------------------\n\nWe believe that there are few sources of increased cost except where corners are being cut by not following guidelines. ",
"If postoperative patients are discharged to the community, it will cost more in the short term to bring these to a clinic despite the prospect of longer term cost-savings provided by better care. ",
"Exercise testing is underutilised in Europe with approximately 10% of those suitable actually having a stress test. ",
"The time required for an echocardiogram may be longer in a valve clinic, typically 60 rather than 40 min.",
"\n\nLimitations {#s5}\n===========\n\nThis paper is meant to incite discussion and debate by trying to flesh out a more detailed assessment of costs and savings associated with heart valve clinics than the ones available so far in the literature. ",
"Because our figures are hypothetical, rather than derived from actual observation, they cannot be considered definitive. ",
"However, the assumptions we made are as close to the reality of contemporary UK clinical practice as possible. ",
"It was necessary to limit our findings to the UK context in order to be able to provide the level of detail that we were aiming for. ",
"This may make our findings somewhat parochial, but we think that the assumptions and the categories used in our calculations have the potential for generalisation in other systems, which the cost calculator should greatly facilitate.",
"\n\nWe did not include outcome data because the primary focus of this paper was to analyse the financial implications of valve clinics; what little outcome data are available will be found in the references quoted.",
"\n\nConclusion {#s6}\n==========\n\nThere is a growing body of observational and circumstantial evidence supporting the notion that patient-centred care is best delivered to heart valve patients within the framework of valve clinics. ",
"The costing implications of valve clinics need to be worked out carefully, through multidisciplinary collaborations, but the available evidence suggests that significant cost-savings can be achieved by avoidance of unnecessary echocardiograms and clinic visits, by the freeing of consultant time, by reducing the likelihood of delayed surgery with its associated morbidities and prolonged hospitalisations, and by avoidance of costly complications such as infective endocarditis. ",
"Clarifying the economic implications of this new model of care should become one of the priorities for the 'heart valve community'.",
"\n\n**Contributors:** JBC suggested the topic and wrote the first draft. ",
"CM designed the costing tool and performed the preliminary analyses. ",
"AI performed the analyses that were included in the final version of the paper and responded to the comments of the reviewers, rewriting the paper in the current format.",
"\n\n**Competing interests:** None declared.",
"\n\n**Provenance and peer review:** Not commissioned; externally peer reviewed.",
"\n\n**Data sharing statement:** The authors would like to make available the automated costing tool (an Excel table with cells customised to provide cost estimates for a virtually limitless number of permutations of the 'ingredients' comprised in a valve clinic) to the readers of the Journal. ",
"The costing tool is available to anyone interested, for free, on request from the corresponding author.",
"\n"
] |
{
"pile_set_name": "PubMed Central"
}
|
[
0,
0,
0,
0,
0,
0,
0,
0,
0.008021390374331552,
0.03278688524590164,
0.0035460992907801418,
0,
0,
0,
0,
0,
0,
0.0009940357852882703,
0,
0,
0.0025575447570332483,
0,
0,
0,
0.00980392156862745,
0.0035842293906810036,
0,
0.006349206349206349,
0.014705882352941176,
0.004201680672268907,
0.003115264797507788,
0.012987012987012988,
0,
0,
0,
0,
0,
0.00046728971962616824,
0,
0,
0.032467532467532464,
0.00130718954248366,
0.0009025270758122744,
0.002688172043010753,
0.006309148264984227,
0.05,
0.004149377593360996,
0,
0.003257328990228013,
0.005405405405405406,
0,
0,
0.008048289738430584,
0.0033222591362126247,
0.01702127659574468,
0.011494252873563218,
0,
0.0016750418760469012,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0.014492753623188406,
0.005917159763313609,
0,
0,
0.003424657534246575,
0,
0
] | 0.003438
| 5
|
[
"The Culture Shock from West to East\n\n“The Sari, it is said, was born on the loom of a fanciful weaver. ",
"He dreamt of a woman, the shimmer of her tears, the drape of her tumbling hair, the colors of her many moods and the softness of her touch. ",
"All these he wove together. ",
"He couldn’t stop. ",
"He wove for many yards. ",
"And when he was done, the story goes, he sat back and smiled and smiled and smiled.”",
"\n\n“The deep involvement and complete sense of identity of the indian woman with the sari, has made her resist the pressure to change her style of dress, inadvertently providing continuity in weaving traditions of every part of the country. ",
"The sari represents a culture in which the woman and textured-with pattern-garment; unpierced or intruded upon by the stitching needle; was considered not only more appropriate in terms of aesthetics and climate, but was also an act of greater purity and simplicity…”\n\nHinduism fostered the growth and development of the sari because of its preference for unstitched clothes for both religious and social reasons. ",
"Although knowledge of sewn garments has existed since prehistoric times, these were mostly reserved for warriors and kings, and never achieved the popularity of drapes. ",
"Therefore, the Indian culture developed the art of wrapping a piece of cloth around the body to a degree that far surpassed that of any other people.",
"\n\nThe sari is known by different names according to the language of an specific Indian region: seere, pudava, lugda, dhoti, etc. ",
"There are more than one hundred drape and wearing styles therefore sari is the most unique and versatile of garments.",
"\n\nIn deference to British and foreign presence in the country, the sari evolved from one single – piece to two pieces. ",
"The urban wearing style is a post -1870‘ s phenomenon and is described as follows in Chitra Debi’s book “Thakur Barir Onder Mohal”:\n\nGyanoda Nandini\n\n“It is said that Satyendranath (elder brother of Rabindranath) Tagore’s wife, Gyanodanandini, went with her civil servant husband to Bombay around the 1870s and adopted the Parsi way of wearing the sari, as at that time the local Bengali way was not considered elegant enough for outdoor wear. ",
"On her return to Calcutta we find that this style, now known in the Thakur Barir as the Bombay Dastur, was adopted by all the ladies of the Barir and other society ladies, referred to it as the “Thakur Barir Sari”. ",
"In fact when Gyanoda advertised her willingness to teach this style of wearing the sari – with a saya or petticoat, chemise\n\nGyanoda Family\n\nblouse and jacket – it attracted a number of women. ",
"It seems to have been a time when a number of ladies were experimenting with supposedly more sophisticated ways of wearing the sari. ",
"The sari went through various stages of resembling the hobble skirt and the gown. ",
"At one stage, the pallav (end piece) was made so short that it could not cover the head and thus, a mukut (crown/tiara) was worn with a flowing backcloth. ",
"Suniti Devi, the Maharani of Cooch Behar, preferred to have a scarf over the head, worn like a spanish mantilla. ",
"Eventually, the traditional way seemed to make a comeback with some alterations in the early twentieth century, for the pallav was brought back over the head by Gyanoda’s daughter, Indira\n\nSuniti Devi\n\nDevi. ",
"We find that Suniti Devi’s sister Sucharu Devi, Maharani of Mayubhanj, was seen at the Delhi Darbar in 1903 in this modern style of wearing the sari, though she said that this was her in-laws’ ways of wearing it. ",
"Bengali ladies seem to have adopted this more convenient way, though they kept Gyanoda’s way of taking the pallav over the left shoulder”\n\nThe evolution of fashion in India have been triggered by various socioeconomic movements during the twentieth century.",
"\n\n“During the ’20s, one of the greatest influences on dress code was the movement towards equal status for women. ",
"Hence, a new breed of business-like women emerged and made corresponding demands on their dress, says A.K.G Nair, Director, Pearl Academy of Fashion. “",
"The obvious choice for silhouette veered towards dropwaist or box and the choice of colour was black and grey and the fabrics preferred were silk and georgettes” he says.",
"\n\n1960's Poster\n\nIn India, the fashion scenario was in confusion as it was a turbulent period of conflicting ideologies, when the consciousness of an Indian national identity was beginning to find political expression and the struggle for Indian independence was getting momentum…” says fashion designer Ritu Kumar. ",
"Thus the fashion trends within high society, read the loyalty, was strongly influenced by the British with the result that western clothes became a status symbol.",
"\nThe ’30s heralded the idea of socialism,communism and fascism and women’s fashion became more and more\n\n1970's Poster\n\nfeminine in keeping with conservative ideas. “",
"However this period also saw the emergence of the vamp and the culture of cabaret ” says Nair, noting that hence the dresses became more body hugging and the colours deep and dark in tune with such themes.",
"\nThe establishment of the Indian cinema also proved to be the strongest influence on the fashion in the decade. ",
"Due to the western influence, the use of angarkhas, choghas and jamas diminished considerably by this time, although the ceremonial pagri, safa and topi were widespread as ever. “",
"They had been replaced by the chapkan, achkan and sherwani, which are still standard items of formal dress for Indian men today ” says Kumar.",
"\n\n“The women even though were accepting change, continued to wear their peshwaz, kurtas, ghaghras and dohnis at religious and ceremonial festivities, sometimes using imported fabrics but using mostly traditional handwoven fabrics” says Asha Baxi, Director Fashion Design. ",
"National Institute of Fashion Technology(NIFT).",
"\nIn the ’40s,it was Christian Dior who turned fashion upside down with a new shape, with the bosom pushed up and out, a pinched waist and hips emphasised with short fluted jackets. “",
"It was also a decade marked by the second World War and the ensuing independence of India with the result that women’s clothing was simple and functional ” says Nair.",
"\n\nThe ’50s saw the dawn of art colleges and schools, which became places of rebels, and hence in silhouette, narrow waist and balloon skirts with bouncing patterns were in vogue. ",
"Also due to the freedom struggle and the espousal of khadi by Gandhiji, khadi garments became a rage giving a boost to the sagging handloom industry, according to Asha Baxi.",
"\n\nThe ’60s one of the most shock-filled decades of the century, saw sweeping fashion and lifestyle changes that reflected the mercurial passions of the times. “",
"This decade was full of defiance and celebration in arts and music and cinema, marked by a liberation from constraints and new types of materials such as plastic film and coated polyester fabric got popular” says Nair. ",
"Besides, adds Bax “Tight kurtas and churidars and high coiffers competed with the mini-skirts abroad and at the same time, designers understood the need of the moment to launch cheaper, ready-to-wear lines”\n\n“One of the most “revisited” and “retro” periods in the fashion, the ’70s is often called the ‘me decade’. “",
"It saw the beginning of “anything goes” culture with the result that fashion became another form of self-expression and bold colours with flower prints were adapted in tunics, with shirts and bell-bottoms” says designer Manav Gangwani. ",
"As drug culture became a mass phenomenon, psychedelic colours were garish, the shoes were tall and hazardous and silhouettes were extreme and the dressing of the ’50s was definitely out.",
"\n\n“The 70s also saw the export of traditional material with the result that export surplus was sold within the country itself and hence, international fashion came to India much before the MTV culture,” says Baxi. ",
"Synthetics became popular and the disco culture had a profound influence on fashion and the clothes became as flashy as the mirrored ball that spins over the dancers.",
"\n\nIn the ’80s the big money ruled. ",
"It was the era of self consciousness and American designers like Calvin Klein became household names. ",
"In India too,silhouettes became more masculine and the salwar kameez was made with shoulder pads” says Baxi, “Power dressing and corporate look became dominant dress code. “",
"The influence of cable TV became more prominent and the teenage market boomed with youngsters going in for the trendy look, which in turn influenced the elders”.",
"\n\nThe ’90s the last decade of the millenium, was one of the extremes. ",
"The excess of the early decade gave way to the drastic pairing down and stripping away in the hands of German designers like Helmut Lang and Jil Sander. “",
"Perhaps the biggest fashion news of the ’90s has been the ascendancy of the younger generation of designers into the mainstream. ",
"The decade also looked for independent women with comforts, poise and confidence as key features,” says Nair.",
"\n\nBut the decade also saw the revival of ethnicity with films too becoming more discreet and launching a “back to ethnic” look.",
"While on the one hand the new drive for information technology popularized the corporate look, an ethno-cultural revival made people again go back to the traditional forms of art and crafts” states Baxi “As it is Indian fashion is extremely alive and whatever the decade or the century, it is here to stay. ",
"For not only it is comfortable, practical and aesthetically beautiful but has changed with time with the result that it has, in the past century, and will in the coming one, remain contemporary” she sums up.",
"\nAlthough sari is a fast disappearing garment for everyday wear, it will survive as special occasion wear. ",
"More and more Indian women today prefer stitched garments and Western wear of easy – to – maintain and wash – and – wear fabrics. ",
"And yet there was a time when ladies rode horses wearing saris and even swan in rivers with their saris tucked between the legs, much like an unstitched pair of shorts. ",
"Saris were even draped longer in pantaloon – like fashion. ",
"If the principles of these wearing styles were put into practice, many more could possibly be evolved for contemporary needs. ",
"Interestingly, the sari is asserting a growing presence in the boardrooms of multinational corporate organizations, in law chambers, courts and among the new power professionals who are conscious of their identity and draw strength from it.",
"\n\nne of the most remarkable features of Indian apparel is the ingenious way in which a simple length of unstitched cloth is used. ",
"Gracefully drapped as a sari, or wrapped around the head as a turban, the length of fabric is versatile and is worn by men and women. ",
"Today, despite the growing influence of contemporary Western fashion trends, most Indians continue to dress traditionally. ",
"Stitched garments include the kurta (for men), kurti (for women), pyjama, sherwani, lehenga choli and of course, the trouser, shirt and ubiquitous blue jeans. ",
"The sari, particularly, is still worn all over India, even though the style of draping it differs from region to region.",
"\n\nShalwar Kameez\n\nThe court nobles of Ottoman and Qajar dinasty upheld Shalwar Kameez as their court costume, hence, this royal background made it reach the heights of fame. ",
"It was imported to India by the Muslim invasion that set off in the 12th century. ",
"The Turko-Iranian regime of the Delhi Sultanate and later the Moghul Empire in India sustained the tradition of dressing in Shalwar Kameez. ",
"The rest of the story is the rising of this garment to popularity.",
"\n\nIt has received the greatest embrace from North India, especially the region of Punjab, and sometimes it’s called “Punjabi Suit”. ",
"This is the national dress for both men and women in Pakistan and Afganistan.",
"\n\nSometimes shalwar is pronounced salwar but basically both are referring to same outfit. ",
"The word “salwar” or “shalwar” comes from the Persian that means pants and the word “kameez” comes from the Latin “camisia” from which it probably made its way into various European languages (chemise) and into the Arabic as “quamiz”.",
"\n\nThe shalwar or salwar is a sort of loose pyjama like trouser. ",
"Traditionally it is wide from top. ",
"It has 4 to 5 inches belt attached to rest part of the shalwar which is pleated. ",
"Upper part of the belt has tunnel for drawstring. ",
"Normally the traditional shalwar size from top at waist is almost double as the actual size to make it comfortable to wear. ",
"It has big room at the thigh area and almost double bottom size as the circumference of the ankle so as to make proper space for the feet to put inside for wearing.",
"\n\nThe kameez traditionally is long up to knee with wide circumference (gher) and with full sleeves. ",
"It is almost fully covered from the back as back neck line depth like 2-3” and medium low at the front like 6-7” inches as front neck line depth.",
"\n\nThe dupatta (scarf or shawl) is the third piece of the Shalwar Kameez set. ",
"It is usually worn around head or neck.",
"\n\nFor Muslim women, the dupatta is a less stringent alternative to Chador or Burqa.",
"\n\nFor Hindu women (especially those from Northern India), the dupatta is useful when the head must be covered as in temples or the presence of elders. ",
"For other women, the dupatta is simply a stylish accessory that can be worn over one shoulder or draped around the chest and over both shoulders.",
"\n\nThe Traditional style is the baggy style pants and a full sleeve tunic but nowadays the contemporary outfit follows the trends set by the fashion industry. ",
"The Bollywood film industry is a great trendsetter. ",
"The shalwar kameez that Bollywood actresses wear in movies are lapped up by their fans. ",
"Soon, a particular outfit design made popular by a movie actress will be seen on the display windows of showrooms.",
"\n\nChuridar style is quite popular amongst the Indian community. ",
"The bottom part of the garment has a different design as compared to the traditional style.",
"It is sleek in look and has leg shape fitting with less amount of thigh and upper space. ",
"At bottom it has small hole with hooks or thread to close the bottom at the ankle. ",
"It is longer than traditional shalwar for spiral shape look at the bottom. ",
"Churidar has different designs as per the market trend and requirements.",
"\n\nPatiala style is similar to traditional style except that Patiala shalwar has more pleats and big fall comes on wearing at back. ",
"This design has a special historical background. ",
"There is a story behind the name. ",
"Patiala is a place in Punjab at North India. ",
"In ancient times, Maharaja (King) of Patiala was very famous. ",
"His dress was a pleated and baggy type shalwar with long loose kameez with full sleeves. ",
"He used to wear this dress as a king and for comfort also. ",
"In the new modern era, the women community copied his dress and named Patiala.",
"\n\nAnarkali style is a long kurti with short, full and half sleeves, but tight at arms, fit and tight above the waist and below the butts like an umbrella. ",
"It is sometimes called Anarkali Umbrella Kameez. ",
"Anarkali means pomegranate blossom and she was a legendary slave girl from Lahore (Pakistan) during the Mughal period. ",
"Her name was Raj Nartika and she was a dancer at palace of Great Mughal emperor Akbar. ",
"She was supposedly ordered to be buried alive by Mughal emperor Akbar for having an illicit relationship with Prince Nuruddin Salim later to become Emperor Jahangir. ",
"Due to the lack of evidence and sources, the story of Anarkali is widely accepted to be either false or heavily embellished. ",
"Nevertheless, her story is cherished by many and has been adapted into literature, art and cinema.",
"\n\nThe dance called mujra or mujara was famous that time. ",
"Famous dancers at palace of Mughal kings dance for entertainment of Mughal kings. ",
"So, the dresses were worn by the dancers while mujra dance called as mujra / mujara dresses. ",
"Later they got famous by name Anarkali dresses or Anarkali shalwar kameez in the remembrance of a great dancer and a passionate lover Anarkali.",
"\n\nLatest designs of Anarkali dresses are popular and in fashion trends wearing with different prints, materials, embroidery work, different designer sleeves and stylish necks.",
"\n\nShalwar kameez also appears as a part of men wardrobe.",
"\n\nDifferent companies in India offer ready made shalwar kameez or unstitched material which can be sew as per given measurements. ",
"It is a sort of pre designed kit of three pieces, tunic, pants and dupatta.",
"\n\nKurti\n\nThe kurti is a tunic and it is related to Roman civilization. ",
"It was a common clothing wear under toga (like a long sari) by male community. ",
"In ancient times, tunic used to indicate the wearer’s status in Roman society by the presence of stripes and ornamentation work on it.",
"\n\nIn Western culture it was mainly used as religious uniform but from last few years when Indian kameez or Kurtis (for ladies) got popularity in Western society it became part of the global wardrobe. ",
"It is usually worn with parallel pants or jeans. ",
"These are available in different fabrics e.g. silk, cotton, chiffon, crepe, etc and different type of work e. g. sequin, beaded, embroidery, etc\n\naised on a Western society probably one of the most shocking thing you notice about India are the arranged marriages.",
"\n\nAfter 3 years blogging about this country I’ve got emails from foreign ladies asking about the amount of dowry they have to pay to get a “good indian boy”. ",
"Dowry was banned in India after the passage of the Prohibition of Dowry Act in 1961, but many people still practice the system of dowry.",
"\n\nFew Westeners realize the importance of the family in Asian cultures. ",
"Likewise, few Westeners are aware that many Asians are horrified by the lack of family feelings and loyalty shown in Western nuclear families in comparison to the support and security of the traditional Asian extended family. ",
"The term “extended family” does not necessarily means relatives living under the same roof or owning communal property. ",
"It refers to kin: “who are bound by mutual rights and obligations subscribe, at least nominally, to a hierarchy of authority among its members”\n\nNeedles to say, the males of the family have greater authority over the females within the same age categories, although older females do have the power over younger males. ",
"As most people are expected to marry, a girl in this community is under some authority all her life, first as a daughter, then as a wife. ",
"Only when she herself becomes a mother in law, does she see her own authority increased, especially if the newly wedded couple live under her roof.",
"\n\nIndian children are not brought up to consider themselves individuals, entitled to take their own decisions, but, rather, as members of a group, which reach decisions all together. ",
"Relationships are not on a one – to – one basis as in many Western cultures, but rather between family units. ",
"Every Asian knows s/he is part of a “biradari”, an extended kinship group or clan. ",
"They know that they are never alone, they are confident in having the support of a larger number of people behind them. ",
"On the other hand, they only have the advantages of this network of support provided that they keep the rules. ",
"The rules stipulate that its members must not disgrace it and must comply with the decisions taken by the elders. ",
"Marriages among Indians are not seen as a contract between two individuals, as they usually are in the West, but as an union of two families. ",
"The suitability of the prospective husband or wife as regards his/her character, caste or income has far more importance then whether the couple actually like each other. ",
"Indians would say that love comes after marriage. ",
"A similar background is essential, whereas physical attraction may not last.",
"\n\nIndian tradition says that parents have more experience than children and are therefore more likely to choose the right person. ",
"Children accept this because “Obedience is a extremely important foundation of Indian family relationships and agreement is frequently reached on the basis of acceptance of the parent’s authority”\n\nMoreover, the whole family must be considered suitable, not just the young man or woman, which explains why parental knowledge of life has more weight than a biased adolescent view of a girl or boy-friend. ",
"It is argued that arranged marriages are more successful than love marriages because there are more divorces in love matches. ",
"Asian parents who wield statistics to prove this point fail to take into account the lack of figures for failed arranged marriages. ",
"According to tradition, a love marriage means that you are putting yourself first before your culture, your community and even your parents. ",
"If anything went wrong and the union ended in divorce, the parents would disgraced and the divorced partners would be rejected by the community at large. ",
"If an arranged marriage fails, the whole family unites behind the husband or wife and thus, as it were, shoulders the blame.",
"\n\nIt must be said, nevertheless, that arranged marriage is the tyrannical system it is made out to be by the media. ",
"The publicity it receives is always in terms of girls being forced and parents being cruel. ",
"In reality, it is much less traumatic, much more “semi-arranged”.",
"\n\nNowadays there seems to exist a liberal version of the arranged marriage. ",
"The parents look for a suitable match through a network of relatives and friends. ",
"When they are satisfied with the boys’s background, financial standing and education and the girl’s character, family background and ability to manage a home, sometimes photographs are exchanged. ",
"If the couple feel attracted to each other, a chaperoned meeting is arranged. ",
"If this encounter does not dampen the initial interest, the marriage can be said to be on. ",
"Should the couple not feel suited, another round of enquiries ensues. ",
"The final decision rests with the boy and the girl not with the parents, as used to be the case. ",
"It is doubtful whether this means a kind of progress towards liberation as, underneath it all, the system is surely the same. ",
"Girls are not allowed to object to the principles of it and certainly cannot go on refusing for ever. ",
"An important reason why parents are loath to leave this decision entirely in their daughter’s hands is their fear of her choosing someone outside her religion or caste, but not so much because of divine disapproval but rather because of the reproof of society. ",
"Indian society is an extremely conservative one and stepping out of one’s place is deeply frowned upon.",
"\n\nIndian boys are, perhaps surprisingly, compliant as far as arranged marriages are concerned. ",
"Only a minority refuse to conform. ",
"Among Hindus and Sikhs a new wife brings a large dowry with her, which nowadays is usually the payment of a mortgage, so it is easy to see why it would be against their interests to rebel against apparent parental tyranny when they are assured a rent-free future. ",
"From a privileged male standpoint, arranged marriages can be seen to have numerous advantages.",
"\n\nThe institution of arranged marriage is alive and well among Asians communities nowadays.",
"\n\nSometimes there is a kind of contradiction in attitudes for Asian parents who are often pleased and proud that their daughters are educated and can occupy positions when they get a good job, but in many cases they are afraid that the price they will have to pay for having another family member with a respectable income is too high should the girl become too “westernized”.",
"\n\nIn Indian or Pakistani villages, if marriages were not arranged by the family, it stands to reasons that many women remain single.",
"\n\nArranged marriages have been put on a par with computer dating, which of course is not disapproved of in the West.",
"\n\nThe Western emphasis placed upon individual choice may seem to suggest that only marriages chosen by the couples themselves can bring happiness, but the Eastern belief in family wisdom creates a confidence and trust in arranged marriages. ",
"The careful matching of backgrounds and associated customs and values is a key quality of arranged marriages which remains relevant even as relations between the sexes change.",
"\n\nConsidered in this way, it stands to reason that marriage seen as a watertight, carefully prepared, permanent contract as opposed to the risky, often short-lived gamble which it is in most Western cultures, is more likely to prove lasting and successful in the former case. ",
"It can not be ignored, however, that even in so-called “free choices” marriages, partners are frequently selected from similar personal, social and cultural backgrounds.",
"\n\nIt is even more difficult to understand how young Asians, educated in Western cultures, can still identify with their Asianness after contact with what the Westerners see as a superior or more advanced culture. ",
"Conflicts between parents and teenage children exist among all cultures, but when such problems arise in Asian families, it is often assumed thats the parents are being excessively authoritarian and the adolescents are desperately trying to shake off their Assian “yoke”.",
"\n\nLeaving home may be a satisfactory solution for many teenagers in Western cultures when the home atmosphere becomes too tense, but among Asians the feeling of loyalty and obligation to the family makes taking such a step virtually impossible for the majority.",
"\n\nThere is a cliché that children of Asian migrants are “torn between cultures”. ",
"On the contrary, the second generation, and certainly the third generation to a much larger extent, have access, as it were, to two cultural resources, which they can use in a flexible and accomplished way, depending on the situation. ",
"Thus, they can move confidently in both the Asian and Western worlds, although most scholars would claim that “their roots lie in the resourses of Asian cultures”"
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0.007751937984496124,
0,
0,
0.006756756756756757,
0,
0,
0,
0,
0,
0.008849557522123894,
0.009615384615384616,
0.014084507042253521,
0.0038910505836575876,
0,
0.013245033112582781,
0,
0.0031645569620253164,
0,
0,
0.004878048780487805,
0,
0,
0.014184397163120567,
0.007352941176470588,
0.02127659574468085,
0.005494505494505495,
0.006024096385542169,
0,
0.011560693641618497,
0,
0.0045662100456621,
0.0031645569620253164,
0.00423728813559322,
0,
0.009345794392523364,
0,
0,
0.00980392156862745,
0.005780346820809248,
0,
0,
0.012987012987012988,
0,
0.009174311926605505,
0,
0.003257328990228013,
0,
0.009345794392523364,
0,
0,
0.01694915254237288,
0,
0,
0,
0,
0,
0.006289308176100629,
0,
0.011494252873563218,
0,
0,
0,
0.007575757575757576,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0.024096385542168676,
0,
0,
0,
0.019230769230769232,
0,
0,
0,
0,
0,
0,
0,
0,
0.007633587786259542,
0,
0,
0,
0.016129032258064516,
0,
0,
0,
0,
0.02040816326530612,
0.008403361344537815,
0.022988505747126436,
0,
0.008,
0,
0,
0,
0.010752688172043012,
0.006993006993006993,
0,
0,
0,
0,
0,
0,
0,
0.005,
0,
0,
0,
0.014705882352941176,
0,
0.004424778761061947,
0,
0.0031446540880503146,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0.006493506493506494,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0.004149377593360996,
0,
0,
0,
0.004694835680751174,
0,
0,
0,
0,
0
] | 0.002375
| 5
|
[
"\r\n \r\n \r\n \r\n\r\n\r\n\r\n\r\nonerror {resume}\r\nquietly WaveActivateNextPane {} 0\r\n\r\n\r\n add wave -noupdate /mem_tb/status\r\n add wave -noupdate /mem_tb/mem_synth_inst/bmg_port/CLKA\r\n add wave -noupdate /mem_tb/mem_synth_inst/bmg_port/ADDRA\r\n add wave -noupdate /mem_tb/mem_synth_inst/bmg_port/DINA\r\n add wave -noupdate /mem_tb/mem_synth_inst/bmg_port/WEA\r\n add wave -noupdate /mem_tb/mem_synth_inst/bmg_port/DOUTA\r\nTreeUpdate [SetDefaultTree]\r\nWaveRestoreCursors {{Cursor 1} {0 ps} 0}\r\nconfigure wave -namecolwidth 150\r\nconfigure wave -valuecolwidth 100\r\nconfigure wave -justifyvalue left\r\nconfigure wave -signalnamewidth 1\r\nconfigure wave -snapdistance 10\r\nconfigure wave -datasetprefix 0\r\nconfigure wave -rowmargin 4\r\nconfigure wave -childrowmargin 2\r\nconfigure wave -gridoffset 0\r\nconfigure wave -gridperiod 1\r\nconfigure wave -griddelta 40\r\nconfigure wave -timeline 0\r\nconfigure wave -timelineunits ps\r\nupdate\r\nWaveRestoreZoom {0 ps} {9464063 ps}\r\n"
] |
{
"pile_set_name": "Github"
}
|
[
0.005159958720330237
] | 0.00516
| 5
|
[
"Burnout syndrome: a disease of modern societies?",
"\nIn the light of social change and a transformation in the work situation, interest in the problem of burnout has grown over the past decade. ",
"There is a conspicuous discrepancy, however, between what is regarded as certain knowledge and what is published opinion. ",
"To date, there is no generally accepted definition of burnout, or binding diagnostic criteria. ",
"According to the most common description at present, burnout syndrome is characterized by exhaustion, depersonalization and reduced satisfaction in performance. ",
"Because of its aetiopathogenesis, burnout is today mainly regarded as the result of chronic stress which has not been successfully dealt with. ",
"This paper gives an overview of the current definition for burnout syndrome and states possible contemporary hypotheses for its aetiology. ",
"By examining diagnostic criteria and possible therapies, methods of prevention are discussed. ",
"There is an urgent need for further investigations to determine whether burnout syndrome is a work-related disease."
] |
{
"pile_set_name": "PubMed Abstracts"
}
|
[
0,
0,
0,
0,
0,
0,
0,
0,
0
] | 0
| 5
|
[
"Investigation of the cellular tropism of bovine immunodeficiency-like virus.",
"\nBovine immunodeficiency-like virus (BIV) was first isolated from an animal showing transient leucocytosis, lymphadenopathy, lesions in the central nervous system and progressive weakness and emaciation. ",
"Similar signs are observed in other immunosuppressive lentiviral infections. ",
"BIV, like other lentiviruses, has been isolated from peripheral blood mononuclear cells and lymphoid tissue of infected animals. ",
"However, the in vivo cellular tropism of BIV remains unclear although initial studies indicate that BIV may be pantropic, infecting T cells, B cells and monocytes similar to some of the immunodeficiency-causing lentiviruses. ",
"PCR, Southern blot hybridisation, cell culture and reverse transcriptase assays were used to demonstrate the presence of BIV proviral DNA and the production of infectious virus in CD2+, WC1+, B cells and monocytes during the acute stages of infection. ",
"Western immunoblot assays were used to assess the development of antibody responses towards the virus."
] |
{
"pile_set_name": "PubMed Abstracts"
}
|
[
0,
0,
0,
0,
0.0044444444444444444,
0.003968253968253968,
0
] | 0.001202
| 5
|
[
"Our View: Finish campaign season with your vote in election\n\nIs it just us or is this the longest campaign season in history? ",
"The raucous City Council election behavior that started in early spring and picked up steam in the divisive infighting of the primary elections continued into the most expensive and perhaps bitterly fought presidential race in recent memory.",
"\n\nWe have been polled, re-polled, told we are socialists or patriots, subjected to some of the finest fiction ever seen on television, and at the end of the day we have the same choice we always have. ",
"Performance versus promise.",
"\n\nAs worn out as we all might be by this marathon of vitriol, there is one important task left to complete. ",
"The central privilege of the Republic is the right and responsibility to vote. ",
"Many of us have voted already with absentee ballots. ",
"By most accounts this could be the most important presidential election in decades. ",
"Rarely have we had such a clear and distinct choice between two candidates and the direction our country will take.",
"\n\nUnemployment, underemployment and the tenuousness of our own employment affects all Americans. ",
"Larger government or smaller government will touch everyone with the role that government plays in our lives. ",
"The future complexion of the Supreme Court, moving to the left or moving to the right, may someday be seen by historians as the most significant impact of all. ",
"America’s place and role on the world stage will most certainly be shaped by this election. ",
"How the next administration deals with budget deficits and the national debt will have dramatic effect on the quality of life for our children and grandchildren. ",
"This is not an election to sit out."
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0,
0.004149377593360996,
0.004975124378109453,
0,
0,
0,
0,
0,
0,
0,
0,
0.00625,
0,
0,
0
] | 0.001025
| 5
|
[
"Q:\n\nGetting different result in different runs with multithreading\n\nwhy when the code executed, the result different every time? ",
"\ni tried to follow how the code is executed, and i confused, i feel this is not sense.",
"\nand the result appear randomly every time\n#!",
"/usr/bin/python\n\nimport Queue\nimport threading\nimport time\n\nexitFlag = 0\n\nclass myThread (threading.",
"Thread):\n def __init__(self, threadID, name, q):\n threading.",
"Thread.__init__(self)\n self.threadID = threadID\n self.name = name\n self.q = q\n def run(self):\n print \"Starting \" + self.name\n process_data(self.name, self.q)\n print \"Exiting \" + self.name\n\ndef process_data(threadName, q):\n while not exitFlag:\n queueLock.acquire()\n if not workQueue.empty():\n data = q.get()\n queueLock.release()\n print \"%s processing %s\" % (threadName, data)\n else:\n queueLock.release()\n time.sleep(1)\n\nthreadList = [\"Thread-1\", \"Thread-2\", \"Thread-3\"]\nnameList = [\"One\", \"Two\", \"Three\", \"Four\", \"Five\"]\nqueueLock = threading.",
"Lock()\nworkQueue = Queue.",
"Queue(10)\nthreads = []\nthreadID = 1\n\n# Create new threads\nfor tName in threadList:\n thread = myThread(threadID, tName, workQueue)\n thread.start()\n threads.append(thread)\n threadID += 1\n\n# Fill the queue\nqueueLock.acquire()\nfor word in nameList:\n workQueue.put(word)\nqueueLock.release()\n\n# Wait for queue to empty\nwhile not workQueue.empty():\n pass\n\n# Notify threads it's time to exit\nexitFlag = 1\n\n# Wait for all threads to complete\nfor t in threads:\n t.join()\nprint \"Exiting Main Thread\"\n\ncode source\nhttp://www.tutorialspoint.com/python/python_multithreading.htm\n\nupdate\nSorry, i mean the order of result\nlike this:\nStarting Thread-1\nStarting Thread-2\nStarting Thread-3\nThread-3 processing One\nThread-2 processing Two\nThread-1 processing Three\nThread-3 processing Four\nThread-2 processing Five\nExiting Thread-1\nExiting Thread-3\nExiting Thread-2\nExiting Main Thread\n[Finished in 3.0s]\n\nand when try again, the result\nStarting Thread-1\nStarting Thread-2\nStarting Thread-3\nThread-3 processing One\nThread-2 processing Two\nThread-1 processing Three\nThread-3 processing Four\nThread-3 processing Five\nExiting Thread-1\nExiting Thread-2\nExiting Thread-3\nExiting Main Thread\n[Finished in 3.0s]\n\nA:\n\nI assume, by \"result\" you mean the execution order. ",
"\nOne idea behind mutithreading is, that you don't have to care about execution order unless you want to specify it explicitely. ",
"You are totally dependent on the underlying operating system, system load, ... etc.",
"\n\n"
] |
{
"pile_set_name": "StackExchange"
}
|
[
0,
0,
0,
0.02,
0.014285714285714285,
0.0015105740181268882,
0.04,
0.003955696202531646,
0,
0,
0
] | 0.00725
| 5
|
[
"Q:\n\nSpring application is loading properties from all of my properties files instead of just the ones I am specifying in context:property-placeholder\n\nI have a spring application that I am attempting to configure differently for different deployment scenarios. ",
" For instance, for integration tests, I want my application to use an H2 in memory database, but for deployment to our pre-production environments, I want to configure a remote MySql datasource. ",
" After doing some digging around, I have landed on an approach that relies on using the element in my application context to specify the properties files that I would like to load. ",
" Here is the relevant snippet from my applicationContext.xml:\n<context:property-placeholder location=\"classpath:META-INF/spring/database_${spring.profiles.active}.properties\"/>\n\nI then define the spring.profiles.active property in my maven POM file, like so:\n<properties>\n <spring.profiles.active>localdev</spring.profiles.active>\n ...\n</properties>\n\nThis will allow the property value to be available to my application when I run \"mvn test\" (which is how I have been executing my unit tests and attempting to resolve this issue)\nI have several different database configuration properties files and they live side-by-side in my /src/main/resources/META-INF/spring folder, here is the relevant subset of my projects folder structure:\nMETA-INF\n|\n+--spring\n| |\n| +--database_build.properties\n| +--database_localdev.propertes\n| +--applicationContext.xml\n|\n+--persistence.xml\n\nAnd here are the contents of each of the two properties files:\ndatabase_build.properties\n#Updated at Thu Apr 26 17:35:43 PDT 2012\n#Thu Apr 26 17:35:43 PDT 2012\ndatabase.persistenceUnit=persistenceUnitH2\ndatabase.driverClassName=org.h2.Driver\ndatabase.url=jdbc\\:h2\\:mem\\:;MODE=MySQL;INIT=create schema IF NOT EXISTS TTS_ADMIN;TRACE_LEVEL_SYSTEM_OUT=3\ndatabase.username=sa\ndatabase.password=\n\ndatabase_localdev.properties\n#Updated at Thu Apr 26 17:35:43 PDT 2012\n#Thu Apr 26 17:35:43 PDT 2012\ndatabase.persistenceUnit=persistenceUnitMySql\ndatabase.driverClassName=com.mysql.jdbc.",
"Driver\ndatabase.url=jdbc\\:mysql\\://localhost\\:3306/TTS_ADMIN\ndatabase.username=ttsaSchemaMgrUsr\ndatabase.password=password\n\nAnd here is the relevant portions of the applicationContext.xml that references these property values to set up the datasource\n<bean class=\"org.apache.commons.dbcp.",
"BasicDataSource\" destroy-method=\"close\" id=\"dataSource\">\n <property name=\"driverClassName\" value=\"${database.driverClassName}\"/>\n <property name=\"url\" value=\"${database.url}\"/>\n <property name=\"username\" value=\"${database.username}\"/>\n <property name=\"password\" value=\"${database.password}\"/>\n <property name=\"testOnBorrow\" value=\"true\"/>\n <property name=\"testOnReturn\" value=\"true\"/>\n <property name=\"testWhileIdle\" value=\"true\"/>\n <property name=\"timeBetweenEvictionRunsMillis\" value=\"1800000\"/>\n <property name=\"numTestsPerEvictionRun\" value=\"3\"/>\n <property name=\"minEvictableIdleTimeMillis\" value=\"1800000\"/>\n <property name=\"validationQuery\" value=\"SELECT 1\"/>\n</bean>\n...\n<bean class=\"org.springframework.orm.jpa.",
"LocalContainerEntityManagerFactoryBean\" depends-on=\"liquibase\" id=\"entityManagerFactory\">\n <property name=\"persistenceUnitName\" value=\"${database.persistenceUnit}\"/>\n <property name=\"dataSource\" ref=\"dataSource\"/>\n</bean>\n\nAs you can tell from this configuration, the persistence unit to load is determine by the value of the database.persistenceUnit property. ",
" Here is my persistence.xml file with both persistence units defined:\n<?",
"xml version=\"1.0\" encoding=\"UTF-8\" standalone=\"no\"?",
">\n<persistence xmlns=\"http://java.sun.com/xml/ns/persistence\" xmlns:xsi=\"http://www.w3.org/2001/XMLSchema-instance\" version=\"2.0\" xsi:schemaLocation=\"http://java.sun.com/xml/ns/persistence http://java.sun.com/xml/ns/persistence/persistence_2_0.xsd\">\n\n <!-- ",
"An MySql persistence unit -->\n <persistence-unit name=\"persistenceUnitMySql\" transaction-type=\"RESOURCE_LOCAL\">\n <provider>org.hibernate.ejb.",
"HibernatePersistence</provider>\n <properties>\n <property name=\"hibernate.dialect\" value=\"org.hibernate.dialect.",
"MySQL5InnoDBDialect\"/>\n <!-- ",
"value=\"create\" to build a new database on each run; value=\"update\" to modify an existing database; value=\"create-drop\" means the same as \"create\" but also drops tables when Hibernate closes; value=\"validate\" makes no changes to the database -->\n <property name=\"hibernate.hbm2ddl.auto\" value=\"validate\"/>\n <property name=\"hibernate.ejb.naming_strategy\" value=\"org.hibernate.cfg.",
"ImprovedNamingStrategy\"/>\n <property name=\"hibernate.connection.charSet\" value=\"UTF-8\"/>\n <!-- ",
"Uncomment the following two properties for JBoss only -->\n <!-- ",
"property name=\"hibernate.validator.apply_to_ddl\" value=\"false\" /-->\n <!-- ",
"property name=\"hibernate.validator.autoregister_listeners\" value=\"false\" /-->\n </properties>\n </persistence-unit>\n\n <!-- ",
"An in-memory persistence unit -->\n <persistence-unit name=\"persistenceUnitH2\" transaction-type=\"RESOURCE_LOCAL\">\n <provider>org.hibernate.ejb.",
"HibernatePersistence</provider>\n <properties>\n <property name=\"hibernate.dialect\" value=\"org.hibernate.dialect.",
"H2Dialect\"/>\n <!-- ",
"value=\"create\" to build a new database on each run; value=\"update\" to modify an existing database; value=\"create-drop\" means the same as \"create\" but also drops tables when Hibernate closes; value=\"validate\" makes no changes to the database -->\n <property name=\"hibernate.hbm2ddl.auto\" value=\"create\"/>\n <property name=\"hibernate.ejb.naming_strategy\" value=\"org.hibernate.cfg.",
"ImprovedNamingStrategy\"/>\n <property name=\"hibernate.connection.charSet\" value=\"UTF-8\"/>\n <!-- ",
"Uncomment the following two properties for JBoss only -->\n <!-- ",
"property name=\"hibernate.validator.apply_to_ddl\" value=\"false\" /-->\n <!-- ",
"property name=\"hibernate.validator.autoregister_listeners\" value=\"false\" /-->\n </properties>\n </persistence-unit>\n\n</persistence>\n\nNow, the problem is that regardless of whether or not I set the spring.profiles.active property to \"build\" or \"localdev\", I always get the property values for the database_localdev.properties file. ",
" I have turned on trace logging and I see the following lines in the log file when the active profile is \"localdev\":\n2012-05-07 17:47:17,155 [main] INFO org.springframework.context.support.",
"PropertySourcesPlaceholderConfigurer - Loading properties file from class path resource [META-INF/spring/database_localdev.properties]\n\nAnd I see this in the log file when the active profile is \"build\"\n2012-05-07 17:47:17,155 [main] INFO org.springframework.context.support.",
"PropertySourcesPlaceholderConfigurer - Loading properties file from class path resource [META-INF/spring/database_build.properties]\n\nSo it would appear that spring.active.profile value is being honored and the correct file is being loaded as a result of my context:property-placeholder settings. ",
" However, the \"build\" file always seems to be loaded and always seems to take precedence over the properties defined in the \"localdev\" file. ",
" The only way I am able to get the property values in the \"localdev\" file to be honored is by commenting out all of the lines in the \"build\" file.",
"\nI am currently baffled by what is going on. ",
" Is there some other rule that I am not considering that would account for both of my properties files to be loaded?",
"\nEDIT\nThe section of my POM related to resource-filtering and property processin:\n<resources>\n <resource>\n <directory>src/main/resources</directory>\n <filtering>true</filtering>\n </resource>\n </resources>\n...\n <plugin>\n <groupId>org.codehaus.mojo</groupId>\n <artifactId>properties-maven-plugin</artifactId>\n <version>1.0-alpha-2</version>\n <executions>\n <execution>\n <phase>initialize</phase>\n <goals>\n <goal>read-project-properties</goal>\n </goals>\n <configuration>\n <files>\n <file>${basedir}/src/main/resources/META-INF/spring/database_build.properties</file>\n </files>\n </configuration>\n </execution>\n </executions>\n </plugin>\n\nA:\n\nIt looks from the POM fragment, that you are filtering your resources, using properties always read from the database_build.properties file.",
"\nThat would mean that the placeholders in the applicationContext.xml are filled by maven during the build using these properties, and there are none left for the placeholder configurer to really configure. ",
"Spring reads only the properties file you tell it to, but by then it is already too late.",
"\n\n"
] |
{
"pile_set_name": "StackExchange"
}
|
[
0,
0,
0,
0.0013633265167007499,
0.006944444444444444,
0.0012547051442910915,
0.0026666666666666666,
0,
0.0196078431372549,
0.015384615384615385,
0,
0,
0,
0.0075,
0,
0,
0,
0,
0,
0,
0,
0.007537688442211055,
0,
0,
0,
0,
0.005263157894736842,
0.01090909090909091,
0.006756756756756757,
0,
0,
0,
0,
0.002654867256637168,
0,
0,
0
] | 0.002374
| 5
|
[
"ARC Review | The Risk (Briar U #2) by Elle Kennedy\n\nA sexy standalone novel from New York Times and international bestselling author Elle Kennedy. ",
"THE RISK takes you back to the world of hot hockey players, feisty heroines, bro banter, and steamy scenes…\n\nEveryone says I’m a bad girl. ",
"They’re only partly right—I don’t let fear rule me, and I certainly don’t care what people think. ",
"But I draw the line at sleeping with the enemy. ",
"As the daughter of Briar’s head hockey coach, I’d be vilified if I hooked up with a player from a rival team.",
"\n\nAnd that’s who Jake Connelly is. ",
"Harvard’s star forward is arrogant, annoying, and too attractive for his own good. ",
"But fate is cruel—I require his help to secure a much-coveted internship, and the sexy jerk isn’t making it easy for me.",
"\n\nI need Connelly to be my fake boyfriend.",
"\n\nFor every fake date…he wants a real one.",
"\n\nWhich means this bad girl is in big trouble. ",
"Nothing good can come from sneaking around with Jake Connelly. ",
"My father would kill me, my friends will revolt, and my post-college career is on the line. ",
"But while it’s getting harder and harder to resist Jake’s oozing sex appeal and cocky grin, I refuse to fall for him.",
"\n\nAfter months of waiting for the release of The Risk, it has graciously landed on my Kindle app. ",
"All thanks to Nina Bocci for the ARC. ",
"Thank you. ",
"Thank you. ",
"As I publish this post, maybe The Risk has reached your Kindles too! ",
"All the waiting for its release is worth it, I tell you.",
"\n\nI’ve been an avid reader of Elle Kennedy since she released The Deal and the rest of her Off-Campus Series. ",
"I love the way she writes, how real and fun her stories are. ",
"She got me so hooked with her college and hockey-based stories, friendship and couples and so there were no questions asked when she dropped Briar U series. ",
"I know I need to read it. ",
"I know I need to sign up for the ARC of this book.",
"\n\nThe Chase, the first book of Briar U series, was an okay read for me. ",
"I wasn’t that crazy over Summer and Fitz. ",
"Me thinks that I should reread it and thoroughly reflect on my thoughts about it once again, though. ",
"But one thing that I know and clearly remember about that book was – how I was seriously teased by Brenna Jensen and Jake Connelly. ",
"Every time they show up, I just want them to go and make out already. ",
"That’s how high the tension between them is. ",
"From that point, I know and I’m very confident that they’d be taking the next story of the series. ",
"Because how can Elle Kennedy waste such characters and steam like that, right? ",
"The exact moment they encountered each other, I know they were going to be such an explosive duo. ",
"The question left there is – how will their characters get tangled up?",
"\n\nKennedy drops The Risk’s synopsis and all I focus on is “I need Connelly to be my fake boyfriend. ",
"For every fake date…he wants a real one.”. ",
"Basically, aside from Enemies to Lovers trope that would fit them, we also get fake dating. ",
"Imagine the tension from all sides and the headlines: Brenna Jensen, the daughter of Briar U’s hockey coach, goes out on a date with Jake Connelly, Harvard’s team captain and star foward, her enemy (her hockey team’s rival).",
"\n\nThe Chase perfectly built up the tension, chemistry and burn that exists between Brenna and Connelly and it was so easy to slip into The Risk. ",
"She’s feisty. ",
"He’s cocky. ",
"Together, they are such a riot. ",
"We already have a grasp of their characters and making every scene that transpire between them a very anticipating one. ",
"Every scene feels like it is a climax.",
"\n\nPlease proceed with caution as some parts may have the teeny tiniest spoilers.",
"\n\nConfident, a spitfire, knows how to hold her own ground and someone who doesn’t easily back down – that’s Brenna Jensen right there. ",
"Exactly the reasons why she blurted out the lie of dating Jake Connelly to HockeyNet’s executive Ed Mulder, the guy who interviewed her for her internship. ",
"Ed Mulder: a misogynist and a typical guy who’s world revolve around sports, he’s obsessed with the Jake Connelly. ",
"Forget that she couldn’t stand Connelly, Brenna wouldn’t back down from Mulder’s misogynist ways. ",
"If she can do something to sway things her way, she would do it for the sake of that internship slot. ",
"Even if she needs to recruit and require help from her enemy.",
"\n\nBut funny how the fake dating trope in the story was cut oh so short. ",
"I could easily count the number they fake dated each other. ",
"I want more. ",
"I’m dying for more. ",
"Just imagine the kick that we’ll be getting out of it. ",
"Brenna and Connelly being sugary sweet on the outside but on the inside, the urge to slit each other’s throats is high just because. ",
"Imagine the crazy banters that they would get into (not saying crazy banters weren’t present but imagine if there were more, Brenna wanting to pull her hair out because of frustration). ",
"I guess, I expected more from the fake dating.",
"\n\nWell, it might have been cut short but it opened a lot more for their relationship. ",
"It didn’t hinder the playful and sexy tones of the book. ",
"Their chemistry is already given and it even burned brighter in this one. ",
"The friction between them because of studying in rival schools just flames it all up. ",
"They’re more like “fake enemies”. ",
"Hear hear, their witty banters is something that I live for. ",
"I love the play of lines and the back and forth. ",
"You’ll see how much they enjoy each other’s company and how they just click. ",
"They get each other. ",
"They’re good for each other. ",
"I’m sure you’ll go aww because of these two.",
"\n\nIt’s not wrong for me to wish that there were more scenes of Brenna applying/venturing towards her internship, right? ",
"I think it would be interesting to read more about Brenna breaking through the bullshit of HockeyNet and the sports journalism world. ",
"But I guess knowing that ending right there could make up for it.",
"\n\nJake Connelly surprised me in a lot of ways. ",
"He lives and breathes hockey. ",
"He may have a tough exterior, cocky (I guess he has all the shots to act like he does because the boy is extremely talented with hockey) but a big revelation to me is how he’s such a huge softie. ",
"Despite Connelly being a big deal in the hockey world, he made me feel that he’s just a regular guy. ",
"A guy who would also crave for his parents’ attention and see even a bit of their interest towards his hockey career. ",
"Yet even they appear disinterested and busy with life, like a good boy that he is he still takes time to visit and eat breakfast with them. ",
"Other kids might fuck off as well because they may think what’s the point, but no, Connelly still give hugs and kisses to his Mom and chats up with his Dad. ",
"His views in school and life are very refreshing to read, as well. ",
"I love being in his head.",
"\n\nTake note this book also have a good dramarama. ",
"Prepare your heart as you get to know more about Brenna and her past. ",
"What she conceals beneath that tough and vibrant personality of hers. ",
"It’s messy and painful that certainly left her a lasting burn. ",
"My gut feeling was right. ",
"I knew it.",
"\n\nHer relationship with her father suffered from it and how they interact with each other was painful to watch. ",
"Nothing ever felt warm and homey between them. ",
"Indifferent more like it. ",
"Her father’s reasoning, I get it but I’m not glad with how he handled it. ",
"How can he not see the effect of his actions? ",
"But I certainly had a good cry when they cracked. ",
"Their pain was very tangible. ",
"It felt like I was holding their heart when they were rehashing about the past and the things that were going through their mind.",
"\n\nAside from the interesting characters, back stories and the all in all solid plot of The Risk, Elle Kennedy is great in incorporating her side characters. ",
"The entire Briar U gang is back and are teasing us about possibilities.",
"\n\nSPOILER\n\nKennedy took this chance to introduce a new pairing – Rupi and Mike Hollis. ",
"Yes, the Mike Hollis. ",
"He’s such a quirky character and I would love to pick on his brain. ",
"But the downside, he’s so immature and petty. ",
"Same with Rupi. ",
"At first, I found her endearing what with her amount of confidence and being a blabbermouth. ",
"But later on she became annoying. ",
"Their relationship isn’t healthy at all. ",
"Both of them just screaming their lungs out and being immature. ",
"There, I think they bring out the little kid in each other (in the worst ways possible).",
"\n\nSPOILER\n\nAs I’m typing this post (February 14th, 11:40-ish here in the Philippines), Elle Kennedy dropped the cover of The Play (Briar U #3)!",
"\n\nSPOILER\n\nThe moment I saw it, I initially thought of Rupi but I don’t think Elle Kennedy would go over Rupi and Hollis’ relationship again. ",
"Especially with that amount of exposure they have in The Risk.",
"\n\nSPOILER\n\nWhy do I have the feeling that it’s going to be the story of Hunter x her girl? ",
"I keep on going back to his talk with Brenna and hmm, it just made me think twice.",
"\n\nBut who knows this story might as well be about Nate’s.",
"\n\nCome on, October, please come faster.",
"\n\nThe Risk made me fall for Brenna and Jake even more. ",
"You know what, the entire time I was reading this the recurring thought in my head was “i must protect these babies”.",
"\n\nBrenna and Connelly’s vulnerability was all over this book. ",
"Coming from two tough characters, it felt like it was an honor for me to see them being stripped down to the core. ",
"Brenna is one tough gal but to see her slowly opening her heart and acknowledging that she could rely on someone else…it was a sight to see. ",
"Same with Connelly. ",
"Despite being married to hockey and a non-relationship type of guy, it was great to see how he dealt with his feelings. ",
"I didn’t expect for him to turn out the way he is. ",
"To see that part of them exist made them human, real. ",
"We may have different experiences and paths in life that we take but insecurities, pain and the what ifs in life – we all have that. ",
"We feel that. ",
"Every day.",
"\n\nWith that being said (obviously I enjoyed reading this book), The Risk is a strong follow-up novel to The Chase and second installment for the Briar U series. ",
"It lived up to the excitement that I built it up in my head and most importantly I had fun with Brenna and Connelly."
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0.027210884353741496,
0,
0,
0,
0.009174311926605505,
0.02857142857142857,
0.012048192771084338,
0,
0,
0,
0,
0.015873015873015872,
0,
0.008547008547008548,
0,
0.05263157894736842,
0,
0,
0,
0,
0.01818181818181818,
0,
0,
0,
0.02,
0.013888888888888888,
0.047619047619047616,
0,
0.015151515151515152,
0,
0,
0,
0.012658227848101266,
0,
0,
0.01,
0,
0,
0.017857142857142856,
0.006896551724137931,
0,
0,
0,
0,
0,
0,
0.007407407407407408,
0.019230769230769232,
0.008695652173913044,
0.01020408163265306,
0,
0,
0,
0,
0,
0,
0,
0,
0.005376344086021506,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0.014925373134328358,
0,
0.02127659574468085,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0.014285714285714285,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0.012738853503184714,
0,
0.022988505747126436,
0.045454545454545456,
0,
0,
0,
0,
0,
0.024390243902439025,
0,
0,
0.006993006993006993,
0.007042253521126761,
0,
0.01098901098901099,
0.012195121951219513,
0.017543859649122806,
0,
0.01818181818181818,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0.006211180124223602,
0
] | 0.004634
| 5
|
[
"[Chronotherapy of bronchial asthma: circadian rhythms in asthmatic symptoms. ",
"Report I: Survey on chronobiology acrophase of asthmatic symptoms].",
"\nWe conducted a questionnaire survey on the onset time and frequency of asthmatic symptoms in adults with bronchial asthma who were regular clinic attendees in 17 sites in Chiba Prefecture, and analyzed 513 respondents. ",
"As a result, the frequency of wheezing was 54.6%, the highest of all symptoms. ",
"Feeling of chest discomfort was 32.2%, followed by asthma attack (13.8%), cough (8.7%) and dynpnea (6.8%). ",
"Asthmatic symptoms were highest from midnight to early morning, with the peak at around 4 o'clock am. ",
"The same pattern was seen regardless of the severity and types of asthma. ",
"This survey also showed that conventional anti-asthmatic therapies decreased the frequency of nightly asthmatic symptoms from the baseline: 7 times or more per week reduced from 44.9% to 16.1%, 3 times or more per week from 76.8% to 40.4%, and at least once per week from 94.4% to 71.5%. ",
"The results suggest that it is important to take another therapeutic strategy, which can administer medications at the appropriate time according to the circadian rhythms in asthmatic patients to better control asthma."
] |
{
"pile_set_name": "PubMed Abstracts"
}
|
[
0,
0,
0.004545454545454545,
0,
0,
0,
0,
0,
0
] | 0.000505
| 5
|
[
"An anomalous left superior venacava draining into left atrium in association with fetal valproate syndrome.",
"\nPrenatal exposure of mother to valproic acid causes teratogenic effects on fetus. ",
"The authors report an 18 h-old girl with typical facial and limbs features of fetal valproate syndrome (FVS) along with abnormal draining of left superior vena cava into left atrium."
] |
{
"pile_set_name": "PubMed Abstracts"
}
|
[
0,
0,
0
] | 0
| 5
|
[
"The long-term objective of this controlled, prospective study is to better understand the consequences of female sterilization in order to reduce negative sequelae. ",
"The specific aims are to 1) determine if, during the first 5 post-surgical years, women undergoing tubal sterilization (TL) experience, physical (primarily menstrual disturbances and increased rates of hysterectomy) or psychosocial changes different from those experienced by control subjects, i.e. vasectomy wives (VAS) and women not planning sterilization (NPS); 2) identify and characterize these changes; 3) compare patterns of regret experienced by TL and VAS subjects; 4) identify antecedents for changes and regret and construct a screening instrument to identify women at high risk for regret; 5) identify antecedents to the timing and choice of male or female sterilization among NPS women who subsequently select sterilization; and 6) maintain contact with the sample should a future follow-up (FU) year be pursued. ",
"Initial (pre-sterilization) and five years of FU data have been collected from over 600 women, as scheduled, and preliminary analyses have been performed on the first three FU years. ",
"Supplemental funding is being requested primarily to analyze the complete six-year data set, with special emphasis on the fourth and fifth FU years. ",
"Data analysis will focus on measuring changes in each group between initial intake and FU years and then comparing such changes across groups, using analyses of variance with repeated measures, preceded by backward stepwise multiple regression to identify significant covariates. ",
"Multiple regression and discriminant function analyses will be the primary methods used to construct the screening instrument. ",
"The hysterectomy analysis will employ logistic regression and Cox's proportional hazards model. ",
"Antecedents to choice of sterilization by NPS women will be determined through multiple regression; if findings justify further causal analyses, LISREL will be used. ",
"LISREL will continue to be used for modeling regret. ",
"Results of this study will: 1) provide patient and physician with needed information regarding likely physical and psychosocial consequences of sterilization so that informed decisions can be made and 2) help identify women at high risk for regret, and thus in need of special pre-surgical counseling."
] |
{
"pile_set_name": "NIH ExPorter"
}
|
[
0,
0.0036319612590799033,
0,
0,
0,
0,
0.010416666666666666,
0.006024096385542169,
0,
0
] | 0.002007
| 5
|
[
"(1) Field of the Invention\nThe present invention refers to a method for activating SIM cards for use in mobile telephones.",
"\n(2) Description of Related Art\nEvery installed, inactive, subscription involving a SIM card generates license costs and other costs for resources consumed for the operators of mobile networks. ",
"This is also true for SIM cards not activated for some time or even cards that are not activated at all. ",
"This is especially true for cards that are used for prepaid mobile telephone services. ",
"Such cards, prepaid cards, are stored in large amounts at non-controllable point-of-sales locations, waiting to get sold. ",
"When manufactured, such a card is provided with information in order to make it possible to use the card immediately after that the card has been sold. ",
"Therefore, also the mobile telephone operator stores information related to each card in the operators HLR (Home Location Register) and AUC (Authentication Center), such as the cards IMSI (International Mobile Subscriber Identity).",
"\nThe cost for an operator is dependent on the number of cards registered in the mobile system. ",
"Manufacturing, handling, logistics and storage of SIM cards also represents costs to the mobile operator. ",
"This cost increases significantly when the amount of different SIM card types that are handled by the operator increases.",
"\nIt is thus essential to the mobile operator to keep the amount of different SIM cars types to a minimum, ideally to one type only.",
"\nA multinational operator can e.g. have several PLMNs (Public Land Mobile Network) within a region all having own SIM cards with own IMSI series and/or different MSISDNs which are the catalogue number, i.e. the telephone number depending on which geographical area the subscriber belongs to.",
"\nIn certain countries the operator may even be obliged to be able to provide at any point of sale in the country, an applicable, usable SIM card to a subscriber who has lost or broken the SIM card. ",
"This implies major costs to the operators.",
"\nThe present invention solves the problem of having many inactive subscriptions in the system by activating the SIM cards when the subscriber is going active for the first time."
] |
{
"pile_set_name": "USPTO Backgrounds"
}
|
[
0.00819672131147541,
0.005154639175257732,
0.01904761904761905,
0,
0,
0,
0.017316017316017316,
0,
0.009433962264150943,
0.008264462809917356,
0.007633587786259542,
0.006872852233676976,
0.010101010101010102,
0,
0.005649717514124294
] | 0.006511
| 5
|
[
"Q:\n\nRoadbuilding machine plowing through the Amazon rainforest using heat beam\n\nIn the 1960s I saw an animated film. ",
"Among other projected advances, there was a large machine that obliterated everything in its path by shining a road-wide beam of light ahead of it -- presumably a \"heat ray\" rather than a laser -- and leaving a new road behind it. ",
"My fragmented memory has a striking scene of this machine cutting through the Amazon rainforest at night, and it says much about those times that the theme was entirely one of progress, with not a thought for the environment, wildlife, or original inhabitants of the region.",
"\nUPDATE: In my original question, I evidently conflated two old memories, the other being a facetious car with concrete wheels bouncing along a rubber highway. ",
"As the sources of the two memories seem to be different, and the car with concrete wheels has definitely been found, I am splitting this part of the question off for a separate answer. ",
"Apologies! ",
"\n\nA:\n\nIf it might be animatronic instead of animated, you might be remembering the road-building machine shown in General Motors' Futurama exhibit at the 1964/1965 World’s Fair. ",
" It uses lasers to clear the jungle and a massive machine that does all the road construction. ",
" Note that it's not a massive heat beam (à la War of the Worlds), but directed cutting lasers.",
"\nYou can see the diorama showing the jungle clearing and road building at 3:52 in this video of the ride:\n\nThe lighting makes it appear as though it's night, and because it's animatronic, it's in motion as though it were working.",
"\n\n"
] |
{
"pile_set_name": "StackExchange"
}
|
[
0.008547008547008548,
0,
0.0036496350364963502,
0,
0,
0,
0.0056179775280898875,
0,
0.010638297872340425,
0,
0
] | 0.002587
| 5
|
[
"Q:\n\nUnable to retrieve dynamically generated content from localStorage\n\nI have an HTML table with the id \"roster1\" that allows users to add table rows with a button click, and I am attempting to save the table state via a \"Save\" button that runs the following piece of code:\nfunction saveRoster () {\n localStorage.setItem('rosterPd1','');\n var roster = document.getElementById ('roster1');\n localStorage.setItem('rosterPd1', roster);\n }\n\nIf I input some static value into 'rosterPd1', then I can use the information written to localStorage with no problem. ",
"However, when I attempt to save the table by using the above code, I get [object HTMLTableElement] returned... which is CORRECT, but not particularly useful! ",
"\nCan someone point me in the right direction on what I would have to do to get localStorage to save the contents of the table itself? ",
"\n\nA:\n\nYou can only save Strings to Storage, but it seems for what you're trying to do, innerHTML will suffice;\nfunction saveRoster() {\n var roster = document.getElementById('roster1');\n if (!",
"roster) return; // not found\n localStorage.setItem('rosterPd1', roster.innerHTML); // store innerHTML\n}\nfunction loadRoster() {\n var roster = document.getElementById('roster1');\n if (!",
"roster) return; // not found\n roster.innerHTML = localStorage.getItem('rosterPd1'); // get+apply innerHTML\n}\n\nAs for why you're getting [object HTMLTableElement], this is what happens when you call toString on a JavaScript reference to a <table>.",
"\ndocument.createElement('table').toString() // \"[object HTMLTableElement]\"\n\n"
] |
{
"pile_set_name": "StackExchange"
}
|
[
0,
0,
0,
0,
0,
0,
0
] | 0
| 5
|
[
"Functional organisation of anterior thoracic stretch receptors in the deep-sea isopod Bathynomus doederleini: behavioural, morphological and physiological studies.",
"\nThe relationship between segmental mobility and the organisation of thoracic stretch receptors was examined in the deep-sea isopod Bathynomus doederleini, which shows a developed adaptive behaviour during digging. ",
"The movements of segments during digging were analysed from video recordings, which showed that a large excursion occurred in the anterior thoracic segments. ",
"Dye-fills of axons revealed four types of thoracic stretch receptor (TSR): an N-cell type (TSR-1), a differentiated N-cell type (TSR-2), a muscle receptor organ (MRO)-type with a long, single receptor muscle (TSR-3) and an MRO-type with a short, single receptor muscle (TSR-4 to TSR-7). ",
"Physiologically, TSR-1 and TSR-2 are tonic-type stretch receptors. ",
"TSR-3 to TSR-7 show two kinds of stretch-activated responses, a tonic response and a phasico-tonic response in which responses are maintained as long as the stretch stimulus is delivered. ",
"Both TSR-2, with a long muscle strand, and TSR-3, with a single, long receptor muscle, have a wide dynamic range in their stretch-activated response. ",
"In addition, TSR-2 is controlled by an intersegmental inhibitory reflex from TSR-3. ",
"These results suggest that, although TSR-1 has no receptor muscle and TSR-2 has a less-differentiated receptor-like muscle, they are fully functional position detectors of segmental movements, as are the MRO-type receptors TSR-3 to TSR-7."
] |
{
"pile_set_name": "PubMed Abstracts"
}
|
[
0,
0,
0,
0.006968641114982578,
0,
0,
0.006666666666666667,
0.011904761904761904,
0.004201680672268907
] | 0.003305
| 5
|
[
"Simulation study of magnetic resonance imaging-guided cortically constrained diffuse optical tomography of human brain function.",
"\nDiffuse optical imaging can measure brain activity noninvasively in humans through the scalp and skull by measuring the light intensity modulation arising from localized-activity-induced absorption changes within the cortex. ",
"Spatial resolution and localization accuracy are currently limited by measurement geometry to approximately 3 cm in the plane parallel to the scalp. ",
"Depth resolution is a more significant challenge owing to the limited angle tomography permitted by reflectance-only measurements. ",
"We combine previously established concepts for improving image quality and demonstrate, through simulation studies, their application for improving the image quality of adult human brain function. ",
"We show in a three-dimensional human head model that localization accuracy is significantly improved by the addition of measurements that provide overlapping samples of brain tissue. ",
"However, the reconstructed absorption contrast is significantly underestimated because its depth is underestimated. ",
"We show that the absorption contrast amplitude accuracy can be significantly improved by providing a cortical spatial constraint in the image reconstruction to obtain a better depth localization. ",
"The cortical constraint makes physiological sense since the brain-activity-induced absorption changes are occurring in the cortex and not in the scalp, skull, and cerebral spinal fluid. ",
"This spatial constraint is provided by segmentation of coregistered structural magnetic resonance imaging (MRI). ",
"However, the absorption contrast deep within the cortex is reconstructed superficially, resulting in an underestimation of the absorption contrast. ",
"The synthesis of techniques described here indicates that multimodality imaging of brain function with diffuse optical imaging and MRI has the potential to provide more quantitative estimates of the total and deoxyhemoglobin response to brain activation, which is currently not provided by either method independently. ",
"However, issues of depth resolution within the cortex remain to be resolved."
] |
{
"pile_set_name": "PubMed Abstracts"
}
|
[
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
] | 0
| 5
|
[
"A wind turbine is an energy conversion system which converts kinetic wind energy into electrical energy for utility power grids. ",
"Specifically, wind incident on blades of the wind turbine generator causes a rotor of the wind turbine generator to rotate. ",
"The mechanical energy of the rotating rotor in turn is converted into electrical energy by an electrical generator. ",
"Because wind speed fluctuates, the force applied to the WTG blades and hence the rotational speed of the rotor/generator can vary. ",
"Power grids however require a constant frequency electrical power to be generated by the wind turbine generator.",
"\nA wind power plant is often referred to as a group of wind turbine generators which are commonly connected to an electrical grid through a common connection point, also known as Point of Common Coupling (PCC). ",
"Additionally the wind power plant may comprise a power plant controller and/or some sort of reactive power compensation equipment, such as STATCOMs or switch capacitors, or others.",
"\nOne or more wind turbines of the wind power plant may be requested to shut down, for example due to a fault in the grid, component failure in the wind turbine generator, wind farm or requested by the grid operator. ",
"The wind turbine generator reduces its power during shut down, the power produced by the wind turbine decreases to zero at a specified rate. ",
"The rate of decrease of power, commonly called the power ramp down rate, is dependent on the power ramp down rate of the generator. ",
"How fast the turbine power can decrease during a shut down is normally limited by the maximum ramp down rate of the generator e.g. 0.2 pu/sec.",
"\nHowever, certain grid codes/utilities may require the turbine to ramp down at a rate faster than the maximum ramp down rate of the turbine/generator e.g. 0.4 pu/sec. ",
"It is also foreseen that some countries may specify in their grid code requirements a minimum ramp down rate of turbines during shut down.",
"\nSome transmission grids may require a rapid decrease in output power from Wind Power Plants (WPP); often such rapid decrease is called a “fast run-back”. ",
"This may be triggered by over-frequency excursions or other grid events.",
"\nRapid power reduction may be archived in different ways, various types of turbine may, due to mechanical loads be restricted in its freedom to perform rapid power reductions, performed by fully shutting down the turbine or by blade pitching.",
"\nHence it is desirable to provide a method of operating a wind turbine to provide a power ramp down which causes limited mechanical loads on the wind turbine generator and its components."
] |
{
"pile_set_name": "USPTO Backgrounds"
}
|
[
0,
0,
0,
0.007633587786259542,
0,
0,
0,
0,
0,
0,
0.007042253521126761,
0.005988023952095809,
0,
0.0064516129032258064,
0,
0,
0
] | 0.001595
| 5
|
[
"\n\nThe Early Bird Gets the Bad Grade - robg\nhttp://www.nytimes.com/2008/01/14/opinion/14kalish.html?ex=1358053200&en=e168a15e27dd2a3a&ei=5090&partner=rssuserland&emc=rss&pagewanted=all\n\n======\nmynameishere\n_lengthening the school day would help \"close the achievement gap between\ndisadvantaged students and their better-off peers.\"_",
"\n\nWell, nothing else worked. ",
"Might as well try something completely stupid.",
"\n\n"
] |
{
"pile_set_name": "HackerNews"
}
|
[
0.0030211480362537764,
0,
0,
0
] | 0.000755
| 5
|
[
"QMI Tile and Stone\nDunsborough based Tile and Stone supplier\nGreat range to select from, large showroom.",
"\nServicing the South West of Western Australia from Bunbury to Augusta including Margaret River and surrounding areas.",
"\nFREE No Obligation Quotes\nWe supply a wide range of Ceramic and Porcelain tiles in all sorts of formats including Mosaics and Feature Tiles.",
"\nWe also provide the Natural Stone options with Travertine, Limestone, Sandstone and Marble in various sizes and thicknesses.",
"\nMake ...\n\nQMI Tile and Stone\nDunsborough based Tile and Stone supplier\nGreat range to select from, large showroom.",
"\nServicing the South West of Western Australia from Bunbury to Augusta including Margaret River and surrounding areas.",
"\nFREE No Obligation Quotes\nWe supply a wide range of Ceramic and Porcelain tiles in all sorts of formats including Mosaics and Feature Tiles.",
"\nWe also provide the Natural Stone options with Travertine, Limestone, Sandstone and Marble in various sizes and thicknesses.",
"\nMake ...\n\nFind all home improvement and repair specialists you could need whatever the job or project you need done at your place, big or small. ",
"If you were looking for kitchen renovation and improvement services in Lowlands (6330), we have you covered.",
"\n\nDo you have a project in mind, we've got the home improvement and repair specialists you need to get it done. ",
"Just enter the type of service you need and your location to find trusted businesses in your area.",
"\n\nAustralians traditionally love the outdoors. ",
"We love to take advantage of the abundant sunny days and warm evenings by entertaining outdoors. ",
"Outdoor rooms and outdoor kitchens along with verandahs, decks, pergolas, patios, cabanas and gazebos provide us with a space to extend our living into the outdoors. ",
"Relaxed, informal entertaining these days is a very popular way to catch up with family and friends. ",
"You would be hard pressed to find an Australian home that does not have some form of outdoor living space.",
"\n\nWhen it comes to tiles we tend to think of the wet areas of the house - kitchen, bathroom and laundries. ",
"But there are so many styles, shapes, sizes and materials of tiles available for many more uses than just our wet areas including floors and walls for living rooms, entry halls, fireplaces and stairs, not to mention outdoor areas such as verandahs, terraces, pathways, entertaining areas and pools."
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0.028846153846153848,
0,
0.0070921985815602835,
0.024,
0.02608695652173913,
0,
0.0070921985815602835,
0.024,
0,
0,
0,
0,
0,
0,
0.006024096385542169,
0,
0,
0,
0.003355704697986577
] | 0.006658
| 5
|
[
"For those that are not familiar with Team Concert, this is the coolest thing since sliced bread. ",
"It is THE tool for software development project planning, management, source code management and more. ",
"Here is a general overview of the features. ",
"In our organization we use the RTC ExpressC version for our clients. ",
"This is a small team version that is free and includes 3 free client access licenses – perfect for our small team.",
"\n\nIf you do not currently use version control (a.k.a. ",
"source code management- SCM), this is an ideal product to start with. ",
"Yes, there is Subversion, which is a good open source product, but it does NOT do all the features that Team Concert does. ",
"SCM is only a part of Team Concert’s features.",
"\n\nUPDATE MAY 2016: This is a bit of an old article, but RTC 6.0.2 is was released this month by IBM. ",
"Visit our CLM page for details, or call us for product pricing, or implementation services.",
"\n\nAbsolutely. ",
"A HATS project is really just another Java EE project. ",
"Actually when I get a company started on HATS I usually introduce the RTC Express C if there is no version control system in place (this is the free version). ",
"What kind of HATS project are you working on?",
"\n\nHere's one tip I'll give you for HATS, and this applies to any version control system you use with it. ",
"There is a file in the project that is nothing more than a time stamp. ",
"Its under WEB-INFresourceUpdate.sts. ",
"Right click on it \"Team>Add to Ignore List\" for RTC. ",
"Subversion and ClearCase have similar ignore lists. ",
"Otherwise, this file will drive you nuts trying to keep it synchronized.",
"\n\nFor ClearCase, you need to use the ClearCase Remote Client rather than the full client version, and I've had success using it on HATS projects in the past. ",
"That said, I personally don't care for ClearCase (and I'm a Rational reseller). ",
"RTC is MUCH easier for version control, plus it gives you all the additional features (agile planning, work item tracking, dashboarding, etc).",
"\n\nYes. ",
"All of the above. ",
"It has a native repository which you can use out of the box. ",
"You can also import from Subversion or ClearCase into the native repository, or you can use Subversion or ClearCase as your repository rather than the native repository if you choose. ",
"It has hooks for those products built in.",
"\n\nThe platform is built on Jazz whose concept is like eclipse. ",
"It's a base platform designed to be integrated into other repositories as well as other work item or bug tracking systems. ",
"It has work item tracking built in, but could connect to bugzilla, jira, or ClearQuest. ",
"It also integrates into instant messaging systems. ",
"I have mine integrated with GTalk.",
"\n\nAlex, RTC is much more than scm. ",
"It handles agile planning, work item tracking, project dashboards, team awareness, and automated builds – features that ClearCase does not have at all. ",
"That said, comparing just the SCM capabilities of the two products there are several differences. ",
"RTC is a more centralized server. ",
"ClearCase is a designed to be distributed across multiple servers yet act as one physical system to the user.",
"\n\nIn my opinion, if you are just starting out, start out with RTC. ",
"Unless you have a very large, globally distributed development team with team clusters in various regions, ClearCase is overkill. ",
"However, if you are already on ClearCase, RTC makes a very nice addition as there is a ClearCase SCM bridge that allows you to manage work items and associate those with change sets in CC. ",
"This gives you traceability between the work items (which may be requirements, bugs, defects, tasks, enhancements, etc) and the group of code changes that are required (called change sets).",
"\n\nFrom the standpoint of administration, RTC is MUCH easier to administer. ",
"ClearCase requires a dedicated sys admin – someone who knows the commands to manage the VOBs and Views (storage elements and associated access to the elements). ",
"With RTC, the admin requirement can be is significantly less as all team members can contribute and a project manager can handle permissions using the GUI rather than command lines.",
"\n\nYou’ve outsourced your application development. ",
"How do you keep intellectual control of your applications?",
"\n\nAbout Us\n\nWe are an information technology consulting firm specializing in the areas of Enterprise Modernization, DevOps, and process improvement. ",
"We are experts at iterative (agile) software development frameworks such as Scrum and SAFe, and in enterprise architectures such as Spring, Java EE, and other such frameworks. ",
"We have successfully helped IT organizations reduce their total cost of operations by refactoring their enterprise IT architecture, updating legacy applications, and moving to more scalable architectural patterns of development."
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0.010309278350515464,
0,
0,
0.014492753623188406,
0,
0,
0,
0.008130081300813009,
0.043478260869565216,
0.019801980198019802,
0,
0,
0.01818181818181818,
0.012578616352201259,
0.022222222222222223,
0.009523809523809525,
0,
0.02702702702702703,
0.018867924528301886,
0.019230769230769232,
0,
0.012658227848101266,
0.0125,
0.007042253521126761,
0,
0,
0,
0.010869565217391304,
0,
0,
0,
0.011363636363636364,
0,
0.029411764705882353,
0.02857142857142857,
0.013157894736842105,
0.01020408163265306,
0.029411764705882353,
0.009174311926605505,
0.014925373134328358,
0.007692307692307693,
0.015873015873015872,
0,
0.013333333333333334,
0.012422360248447204,
0.011049723756906077,
0,
0,
0.006711409395973154,
0.005681818181818182,
0
] | 0.009527
| 5
|
[
"Top 50 British TV Sitcoms\n\nThis page lists in alphabetical order the top 50 British TV sitcoms, as determined by a combination of the results of previous polls, award wins, and BCG's visitor data. ",
"We'll soon begin ordering this list with data from our new 'Like' buttons, so get clicking the shows you love!"
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0.01015228426395939,
0
] | 0.005076
| 5
|
[
"Job: Medical Claims Rep\n\nJob Description\n\nOur client in Norwood, MA is seeking a Medical Claims Rep/Medical Biller for a possible temp to hire opportunity!",
"\n\nThe ideal candidate will have 2-3 years of physician medical billing, insurance carrier or related physician office experience. ",
"Proven knowledge of third party billing rules and regulations, claims resolution and working knowledge of HCPCS, ICD-9 and CPT-4 coding required. ",
"Knowledge and experience with medical terminology, strong computer skills, and good verbal and written communication skills are necessary. ",
"Attention to detail, analytical and problem-solving skills and the flexibility in adapting to changes in policies, regulations and procedures are essential.",
"\n\nMinimum of the a High School diploma (or equivalent education, training or experience) required.",
"\n\nThis is a possible temp to hire opportunity. ",
"40 hours/week with a flexible start time."
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0.012903225806451613,
0,
0.0136986301369863,
0,
0,
0,
0,
0
] | 0.003325
| 5
|
[
"/**\n * Licensed to the Apache Software Foundation (ASF) under one\n * or more contributor license agreements. ",
" See the NOTICE file\n * distributed with this work for additional information\n * regarding copyright ownership. ",
" The ASF licenses this file\n * to you under the Apache License, Version 2.0 (the\n * \"License\"); you may not use this file except in compliance\n * with the License. ",
" You may obtain a copy of the License at\n *\n * http://www.apache.org/licenses/LICENSE-2.0\n *\n * Unless required by applicable law or agreed to in writing, software\n * distributed under the License is distributed on an \"AS IS\" BASIS,\n * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.",
"\n * See the License for the specific language governing permissions and\n * limitations under the License.",
"\n */\npackage org.apache.flume.sink.kite;\n\nimport org.apache.flume.auth.",
"FlumeAuthenticationUtil;\nimport org.apache.flume.auth.",
"PrivilegedExecutor;\nimport org.apache.flume.sink.kite.parser.",
"EntityParserFactory;\nimport org.apache.flume.sink.kite.parser.",
"EntityParser;\nimport org.apache.flume.sink.kite.policy.",
"FailurePolicy;\nimport org.apache.flume.sink.kite.policy.",
"FailurePolicyFactory;\nimport com.google.common.annotations.",
"VisibleForTesting;\nimport com.google.common.base.",
"Preconditions;\nimport com.google.common.base.",
"Throwables;\nimport com.google.common.collect.",
"Lists;\n\nimport java.net.",
"URI;\nimport java.security.",
"PrivilegedAction;\nimport java.util.",
"List;\nimport java.util.concurrent.",
"TimeUnit;\nimport org.apache.avro.",
"Schema;\nimport org.apache.avro.file.",
"DataFileWriter;\nimport org.apache.avro.generic.",
"GenericRecord;\nimport org.apache.flume.",
"Channel;\nimport org.apache.flume.",
"Context;\nimport org.apache.flume.",
"Event;\nimport org.apache.flume.",
"EventDeliveryException;\nimport org.apache.flume.",
"Transaction;\nimport org.apache.flume.conf.",
"Configurable;\nimport org.apache.flume.instrumentation.",
"SinkCounter;\nimport org.apache.flume.sink.",
"AbstractSink;\nimport org.kitesdk.data.",
"Dataset;\nimport org.kitesdk.data.",
"DatasetDescriptor;\nimport org.kitesdk.data.",
"DatasetIOException;\nimport org.kitesdk.data.",
"DatasetNotFoundException;\nimport org.kitesdk.data.",
"DatasetWriter;\nimport org.kitesdk.data.",
"Datasets;\nimport org.kitesdk.data.",
"Flushable;\nimport org.kitesdk.data.",
"Syncable;\nimport org.kitesdk.data.",
"View;\nimport org.kitesdk.data.spi.",
"Registration;\nimport org.kitesdk.data.",
"URIBuilder;\nimport org.slf4j.",
"Logger;\nimport org.slf4j.",
"LoggerFactory;\n\nimport static org.apache.flume.sink.kite.",
"DatasetSinkConstants.*;",
"\nimport org.kitesdk.data.",
"Format;\nimport org.kitesdk.data.",
"Formats;\n\n/**\n * Sink that writes events to a Kite Dataset. ",
"This sink will parse the body of\n * each incoming event and store the resulting entity in a Kite Dataset. ",
"It\n * determines the destination Dataset by opening a dataset URI\n * {@code kite.dataset.uri} or opening a repository URI, {@code kite.repo.uri},\n * and loading a Dataset by name, {@code kite.dataset.name}, and namespace,\n * {@code kite.dataset.namespace}.",
"\n */\npublic class DatasetSink extends AbstractSink implements Configurable {\n\n private static final Logger LOG = LoggerFactory.getLogger(DatasetSink.class);\n\n private Context context = null;\n private PrivilegedExecutor privilegedExecutor;\n\n private String datasetName = null;\n private URI datasetUri = null;\n private Schema datasetSchema = null;\n private DatasetWriter<GenericRecord> writer = null;\n\n /**\n * The number of events to process as a single batch.",
"\n */\n private long batchSize = DEFAULT_BATCH_SIZE;\n\n /**\n * The number of seconds to wait before rolling a writer.",
"\n */\n private int rollIntervalSeconds = DEFAULT_ROLL_INTERVAL;\n\n /**\n * Flag that says if Flume should commit on every batch.",
"\n */\n private boolean commitOnBatch = DEFAULT_FLUSHABLE_COMMIT_ON_BATCH;\n\n /**\n * Flag that says if Flume should sync on every batch.",
"\n */\n private boolean syncOnBatch = DEFAULT_SYNCABLE_SYNC_ON_BATCH;\n\n /**\n * The last time the writer rolled.",
"\n */\n private long lastRolledMillis = 0L;\n\n /**\n * The raw number of bytes parsed.",
"\n */\n private long bytesParsed = 0L;\n\n /**\n * A class for parsing Kite entities from Flume Events.",
"\n */\n private EntityParser<GenericRecord> parser = null;\n\n /**\n * A class implementing a failure newPolicy for events that had a\n non-recoverable error during processing.",
"\n */\n private FailurePolicy failurePolicy = null;\n\n private SinkCounter counter = null;\n\n /**\n * The Kite entity\n */\n private GenericRecord entity = null;\n // TODO: remove this after PARQUET-62 is released\n private boolean reuseEntity = true;\n\n /**\n * The Flume transaction. ",
"Used to keep transactions open across calls to\n * process.",
"\n */\n private Transaction transaction = null;\n\n /**\n * Internal flag on if there has been a batch of records committed. ",
"This is\n * used during rollback to know if the current writer needs to be closed.",
"\n */\n private boolean committedBatch = false;\n\n // Factories\n private static final EntityParserFactory ENTITY_PARSER_FACTORY =\n new EntityParserFactory();\n private static final FailurePolicyFactory FAILURE_POLICY_FACTORY =\n new FailurePolicyFactory();\n\n /**\n * Return the list of allowed formats.",
"\n * @return The list of allowed formats.",
"\n */\n protected List<String> allowedFormats() {\n return Lists.newArrayList(\"avro\", \"parquet\");\n }\n\n @Override\n public void configure(Context context) {\n this.context = context;\n\n String principal = context.getString(AUTH_PRINCIPAL);\n String keytab = context.getString(AUTH_KEYTAB);\n String effectiveUser = context.getString(AUTH_PROXY_USER);\n\n this.privilegedExecutor = FlumeAuthenticationUtil.getAuthenticator(\n principal, keytab).proxyAs(effectiveUser);\n\n // Get the dataset URI and name from the context\n String datasetURI = context.getString(CONFIG_KITE_DATASET_URI);\n if (datasetURI !",
"= null) {\n this.datasetUri = URI.create(datasetURI);\n this.datasetName = uriToName(datasetUri);\n } else {\n String repositoryURI = context.getString(CONFIG_KITE_REPO_URI);\n Preconditions.checkNotNull(repositoryURI, \"No dataset configured. ",
"Setting \"\n + CONFIG_KITE_DATASET_URI + \" is required.\");",
"\n\n this.datasetName = context.getString(CONFIG_KITE_DATASET_NAME);\n Preconditions.checkNotNull(datasetName, \"No dataset configured. ",
"Setting \"\n + CONFIG_KITE_DATASET_URI + \" is required.\");",
"\n\n String namespace = context.getString(CONFIG_KITE_DATASET_NAMESPACE,\n DEFAULT_NAMESPACE);\n\n this.datasetUri = new URIBuilder(repositoryURI, namespace, datasetName)\n .build();\n }\n this.setName(datasetUri.toString());\n\n if (context.getBoolean(CONFIG_SYNCABLE_SYNC_ON_BATCH,\n DEFAULT_SYNCABLE_SYNC_ON_BATCH)) {\n Preconditions.checkArgument(\n context.getBoolean(CONFIG_FLUSHABLE_COMMIT_ON_BATCH,\n DEFAULT_FLUSHABLE_COMMIT_ON_BATCH), \"Configuration error: \"\n + CONFIG_FLUSHABLE_COMMIT_ON_BATCH + \" must be set to true when \"\n + CONFIG_SYNCABLE_SYNC_ON_BATCH + \" is set to true.\");",
"\n }\n\n // Create the configured failure failurePolicy\n this.failurePolicy = FAILURE_POLICY_FACTORY.newPolicy(context);\n\n // other configuration\n this.batchSize = context.getLong(CONFIG_KITE_BATCH_SIZE,\n DEFAULT_BATCH_SIZE);\n this.rollIntervalSeconds = context.getInteger(CONFIG_KITE_ROLL_INTERVAL,\n DEFAULT_ROLL_INTERVAL);\n\n this.counter = new SinkCounter(datasetName);\n }\n\n @Override\n public synchronized void start() {\n this.lastRolledMillis = System.currentTimeMillis();\n counter.start();\n // signal that this sink is ready to process\n LOG.info(\"Started DatasetSink \" + getName());\n super.start();\n }\n\n /**\n * Causes the sink to roll at the next {@link #process()} call.",
"\n */\n @VisibleForTesting\n void roll() {\n this.lastRolledMillis = 0L;\n }\n\n @VisibleForTesting\n DatasetWriter<GenericRecord> getWriter() {\n return writer;\n }\n\n @VisibleForTesting\n void setWriter(DatasetWriter<GenericRecord> writer) {\n this.writer = writer;\n }\n\n @VisibleForTesting\n void setParser(EntityParser<GenericRecord> parser) {\n this.parser = parser;\n }\n\n @VisibleForTesting\n void setFailurePolicy(FailurePolicy failurePolicy) {\n this.failurePolicy = failurePolicy;\n }\n\n @Override\n public synchronized void stop() {\n counter.stop();\n\n try {\n // Close the writer and commit the transaction, but don't create a new\n // writer since we're stopping\n closeWriter();\n commitTransaction();\n } catch (EventDeliveryException ex) {\n rollbackTransaction();\n\n LOG.warn(\"Closing the writer failed: \" + ex.getLocalizedMessage());\n LOG.debug(\"Exception follows.\", ",
"ex);\n // We don't propogate the exception as the transaction would have been\n // rolled back and we can still finish stopping\n }\n\n // signal that this sink has stopped\n LOG.info(\"Stopped dataset sink: \" + getName());\n super.stop();\n }\n\n @Override\n public Status process() throws EventDeliveryException {\n long processedEvents = 0;\n\n try {\n if (shouldRoll()) {\n closeWriter();\n commitTransaction();\n createWriter();\n }\n\n // The writer shouldn't be null at this point\n Preconditions.checkNotNull(writer,\n \"Can't process events with a null writer. ",
"This is likely a bug.\");",
"\n Channel channel = getChannel();\n\n // Enter the transaction boundary if we haven't already\n enterTransaction(channel);\n\n for (; processedEvents < batchSize; processedEvents += 1) {\n Event event = channel.take();\n\n if (event == null) {\n // no events available in the channel\n break;\n }\n\n write(event);\n }\n\n // commit transaction\n if (commitOnBatch) {\n // Flush/sync before commiting. ",
"A failure here will result in rolling back\n // the transaction\n if (syncOnBatch && writer instanceof Syncable) {\n ((Syncable) writer).sync();\n } else if (writer instanceof Flushable) {\n ((Flushable) writer).flush();\n }\n boolean committed = commitTransaction();\n Preconditions.checkState(committed,\n \"Tried to commit a batch when there was no transaction\");\n committedBatch |= committed;\n }\n } catch (Throwable th) {\n // catch-all for any unhandled Throwable so that the transaction is\n // correctly rolled back.",
"\n rollbackTransaction();\n\n if (commitOnBatch && committedBatch) {\n try {\n closeWriter();\n } catch (EventDeliveryException ex) {\n LOG.warn(\"Error closing writer there may be temp files that need to\"\n + \" be manually recovered: \" + ex.getLocalizedMessage());\n LOG.debug(\"Exception follows.\", ",
"ex);\n }\n } else {\n this.writer = null;\n }\n\n // handle the exception\n Throwables.propagateIfInstanceOf(th, Error.class);\n Throwables.propagateIfInstanceOf(th, EventDeliveryException.class);\n throw new EventDeliveryException(th);\n }\n\n if (processedEvents == 0) {\n counter.incrementBatchEmptyCount();\n return Status.",
"BACKOFF;\n } else if (processedEvents < batchSize) {\n counter.incrementBatchUnderflowCount();\n } else {\n counter.incrementBatchCompleteCount();\n }\n\n counter.addToEventDrainSuccessCount(processedEvents);\n\n return Status.",
"READY;\n }\n\n /**\n * Parse the event using the entity parser and write the entity to the dataset.",
"\n *\n * @param event The event to write\n * @throws EventDeliveryException An error occurred trying to write to the\n dataset that couldn't or shouldn't be\n handled by the failure policy.",
"\n */\n @VisibleForTesting\n void write(Event event) throws EventDeliveryException {\n try {\n this.entity = parser.parse(event, reuseEntity ? ",
"entity : null);\n this.bytesParsed += event.getBody().length;\n\n // writeEncoded would be an optimization in some cases, but HBase\n // will not support it and partitioned Datasets need to get partition\n // info from the entity Object. ",
"We may be able to avoid the\n // serialization round-trip otherwise.",
"\n writer.write(entity);\n } catch (NonRecoverableEventException ex) {\n failurePolicy.handle(event, ex);\n } catch (DataFileWriter.",
"AppendWriteException ex) {\n failurePolicy.handle(event, ex);\n } catch (RuntimeException ex) {\n Throwables.propagateIfInstanceOf(ex, EventDeliveryException.class);\n throw new EventDeliveryException(ex);\n }\n }\n\n /**\n * Create a new writer.",
"\n *\n * This method also re-loads the dataset so updates to the configuration or\n * a dataset created after Flume starts will be loaded.",
"\n *\n * @throws EventDeliveryException There was an error creating the writer.",
"\n */\n @VisibleForTesting\n void createWriter() throws EventDeliveryException {\n // reset the commited flag whenever a new writer is created\n committedBatch = false;\n try {\n View<GenericRecord> view;\n\n view = privilegedExecutor.execute(\n new PrivilegedAction<Dataset<GenericRecord>>() {\n @Override\n public Dataset<GenericRecord> run() {\n return Datasets.load(datasetUri);\n }\n });\n\n DatasetDescriptor descriptor = view.getDataset().getDescriptor();\n Format format = descriptor.getFormat();\n Preconditions.checkArgument(allowedFormats().contains(format.getName()),\n \"Unsupported format: \" + format.getName());\n\n Schema newSchema = descriptor.getSchema();\n if (datasetSchema == null || !",
"newSchema.equals(datasetSchema)) {\n this.datasetSchema = descriptor.getSchema();\n // dataset schema has changed, create a new parser\n parser = ENTITY_PARSER_FACTORY.newParser(datasetSchema, context);\n }\n\n this.reuseEntity = !(",
"Formats.",
"PARQUET.equals(format));\n\n // TODO: Check that the format implements Flushable after CDK-863\n // goes in. ",
"For now, just check that the Dataset is Avro format\n this.commitOnBatch = context.getBoolean(CONFIG_FLUSHABLE_COMMIT_ON_BATCH,\n DEFAULT_FLUSHABLE_COMMIT_ON_BATCH) && (Formats.",
"AVRO.equals(format));\n\n // TODO: Check that the format implements Syncable after CDK-863\n // goes in. ",
"For now, just check that the Dataset is Avro format\n this.syncOnBatch = context.getBoolean(CONFIG_SYNCABLE_SYNC_ON_BATCH,\n DEFAULT_SYNCABLE_SYNC_ON_BATCH) && (Formats.",
"AVRO.equals(format));\n\n this.datasetName = view.getDataset().getName();\n\n this.writer = view.newWriter();\n\n // Reset the last rolled time and the metrics\n this.lastRolledMillis = System.currentTimeMillis();\n this.bytesParsed = 0L;\n } catch (DatasetNotFoundException ex) {\n throw new EventDeliveryException(\"Dataset \" + datasetUri + \" not found.\"",
"\n + \" The dataset must be created before Flume can write to it.\", ",
"ex);\n } catch (RuntimeException ex) {\n throw new EventDeliveryException(\"Error trying to open a new\"\n + \" writer for dataset \" + datasetUri, ex);\n }\n }\n\n /**\n * Return true if the sink should roll the writer.",
"\n *\n * Currently, this is based on time since the last roll or if the current\n * writer is null.",
"\n *\n * @return True if and only if the sink should roll the writer\n */\n private boolean shouldRoll() {\n long currentTimeMillis = System.currentTimeMillis();\n long elapsedTimeSeconds = TimeUnit.",
"MILLISECONDS.toSeconds(\n currentTimeMillis - lastRolledMillis);\n\n LOG.debug(\"Current time: {}, lastRolled: {}, diff: {} sec\",\n new Object[] {currentTimeMillis, lastRolledMillis, elapsedTimeSeconds});\n\n return elapsedTimeSeconds >= rollIntervalSeconds || writer == null;\n }\n\n /**\n * Close the current writer.",
"\n *\n * This method always sets the current writer to null even if close fails.",
"\n * If this method throws an Exception, callers *must* rollback any active\n * transaction to ensure that data is replayed.",
"\n *\n * @throws EventDeliveryException\n */\n @VisibleForTesting\n void closeWriter() throws EventDeliveryException {\n if (writer !",
"= null) {\n try {\n writer.close();\n\n long elapsedTimeSeconds = TimeUnit.",
"MILLISECONDS.toSeconds(\n System.currentTimeMillis() - lastRolledMillis);\n LOG.info(\"Closed writer for {} after {} seconds and {} bytes parsed\",\n new Object[]{datasetUri, elapsedTimeSeconds, bytesParsed});\n } catch (DatasetIOException ex) {\n throw new EventDeliveryException(\"Check HDFS permissions/health. ",
"IO\"\n + \" error trying to close the writer for dataset \" + datasetUri,\n ex);\n } catch (RuntimeException ex) {\n throw new EventDeliveryException(\"Error trying to close the writer for\"\n + \" dataset \" + datasetUri, ex);\n } finally {\n // If we failed to close the writer then we give up on it as we'll\n // end up throwing an EventDeliveryException which will result in\n // a transaction rollback and a replay of any events written during\n // the current transaction. ",
"If commitOnBatch is true, you can still\n // end up with orphaned temp files that have data to be recovered.",
"\n this.writer = null;\n failurePolicy.close();\n }\n }\n }\n\n /**\n * Enter the transaction boundary. ",
"This will either begin a new transaction\n * if one didn't already exist. ",
"If we're already in a transaction boundary,\n * then this method does nothing.",
"\n *\n * @param channel The Sink's channel\n * @throws EventDeliveryException There was an error starting a new batch\n * with the failure policy.",
"\n */\n private void enterTransaction(Channel channel) throws EventDeliveryException {\n // There's no synchronization around the transaction instance because the\n // Sink API states \"the Sink#process() call is guaranteed to only\n // be accessed by a single thread\". ",
"Technically other methods could be\n // called concurrently, but the implementation of SinkRunner waits\n // for the Thread running process() to end before calling stop()\n if (transaction == null) {\n this.transaction = channel.getTransaction();\n transaction.begin();\n failurePolicy = FAILURE_POLICY_FACTORY.newPolicy(context);\n }\n }\n\n /**\n * Commit and close the transaction.",
"\n *\n * If this method throws an Exception the caller *must* ensure that the\n * transaction is rolled back. ",
"Callers can roll back the transaction by\n * calling {@link #rollbackTransaction()}.",
"\n *\n * @return True if there was an open transaction and it was committed, false\n * otherwise.",
"\n * @throws EventDeliveryException There was an error ending the batch with\n * the failure policy.",
"\n */\n @VisibleForTesting\n boolean commitTransaction() throws EventDeliveryException {\n if (transaction !",
"= null) {\n failurePolicy.sync();\n transaction.commit();\n transaction.close();\n this.transaction = null;\n return true;\n } else {\n return false;\n }\n }\n\n /**\n * Rollback the transaction. ",
"If there is a RuntimeException during rollback,\n * it will be logged but the transaction instance variable will still be\n * nullified.",
"\n */\n private void rollbackTransaction() {\n if (transaction !",
"= null) {\n try {\n // If the transaction wasn't committed before we got the exception, we\n // need to rollback.",
"\n transaction.rollback();\n } catch (RuntimeException ex) {\n LOG.error(\"Transaction rollback failed: \" + ex.getLocalizedMessage());\n LOG.debug(\"Exception follows.\", ",
"ex);\n } finally {\n transaction.close();\n this.transaction = null;\n }\n }\n }\n\n /**\n * Get the name of the dataset from the URI\n *\n * @param uri The dataset or view URI\n * @return The dataset name\n */\n private static String uriToName(URI uri) {\n return Registration.lookupDatasetUri(URI.create(\n uri.getRawSchemeSpecificPart())).second().get(\"dataset\");\n }\n}\n"
] |
{
"pile_set_name": "Github"
}
|
[
0.009174311926605505,
0.008928571428571428,
0.012195121951219513,
0.009615384615384616,
0.009523809523809525,
0,
0,
0,
0,
0.01818181818181818,
0.017857142857142856,
0,
0,
0,
0.022222222222222223,
0,
0,
0.02857142857142857,
0,
0.030303030303030304,
0,
0,
0.02564102564102564,
0.030303030303030304,
0,
0,
0,
0,
0,
0.023809523809523808,
0,
0.030303030303030304,
0.023255813953488372,
0,
0,
0.02564102564102564,
0,
0,
0,
0,
0,
0.034482758620689655,
0,
0.017543859649122806,
0,
0,
0.03125,
0,
0,
0.01953125,
0.00641025641025641,
0,
0,
0,
0,
0,
0,
0.011363636363636364,
0.006896551724137931,
0,
0,
0,
0.012698412698412698,
0.023809523809523808,
0.00315955766192733,
0,
0,
0,
0,
0.002932551319648094,
0.0027434842249657062,
0.002145922746781116,
0.0016025641025641025,
0,
0.00211864406779661,
0.0016474464579901153,
0.002824858757062147,
0.002680965147453083,
0.00411522633744856,
0.010101010101010102,
0.007936507936507936,
0,
0.011857707509881422,
0,
0,
0.007633587786259542,
0,
0.012345679012345678,
0.0050568900126422255,
0,
0,
0,
0.015873015873015872,
0,
0.011049723756906077,
0.0026455026455026454,
0,
0.004310344827586207,
0,
0.0048543689320388345,
0.00906344410876133,
0,
0.007936507936507936,
0.007246376811594203,
0,
0.002881844380403458,
0.0036900369003690036,
0,
0,
0,
0,
0.016574585635359115,
0.0036101083032490976,
0.0049504950495049506,
0,
0.011764705882352941,
0.009259259259259259,
0.007518796992481203,
0,
0,
0.007246376811594203,
0,
0,
0.005263157894736842,
0.007371007371007371
] | 0.005708
| 5
|
[
"Google has revealed that hackers have been targeting iPhones, its arch rival in the smartphone world, and secretly installing spying devices.",
"\n\nThe revelation comes as Google found evidence of 'monitoring implants' implanted in iPhones to pilfer personal data such as pictures, messages and even locations.",
"\n\nIan Beer, from Google's Project Zero, said in a blog post that the hacked sites had received thousands of visitors each week.",
"\n\nScroll down for video\n\nImplants pilfered personal data such as pictures, messages and even locations Most of the security flaws were found within Safari and on iOS 10 to iOS 12 were targeted in the hack\n\nWHAT IS THE APPLE VULNERABILITY? ",
"Operating systems from iOS 10 to iOS 12 were targeted in the hack. ",
"It was able to access users' apps including Instagram, WhatsApp and Gmail. ",
"Google said it reported the security issues to Apple on February 1. ",
"Apple then released an operating system update on February 7. ",
"Visiting the hacked site was enough for the exploit server to attack your device, and if it was successful, to install a monitoring implant. ",
"Advertisement\n\nMr Beer said: 'There was no target discrimination; simply visiting the hacked site was enough for the exploit server to attack your device, and if it was successful, to install a monitoring implant.'",
"\n\nProject Zero is the technology company's team for examining new security vulnerabilities.",
"\n\nMr Beer said most of the security flaws were found within Safari, the default web browser on Apple devices.",
"\n\nOperating systems from iOS 10 to iOS 12 were targeted in the hack, which was able to access users' apps including Instagram, WhatsApp and Gmail.",
"\n\nGoogle said it reported the security issues to Apple on February 1.",
"\n\nApple then released an operating system update on February 7.",
"\n\niPhone users should check their device is running the most up-to-date version of iOS in order to ensure they are protected from the flaw.",
"\n\nUsers can check their software version by going to the Settings app on their device, selecting General and then tapping on the Software Update option.",
"\n\nAny required updates will then be displayed here, which users can select to install.",
"\n\nThe most recent update currently available is iOS 12.4.1.",
"\n\nMr Beer warned that while the implant is not saved on Apple devices, it can again provide access to hackers when the owner visits a 'compromised site'.",
"\n\n'Given the breadth of information stolen, the attackers may nevertheless be able to maintain persistent access to various accounts and services by using the stolen authentication tokens from the keychain, even after they lose access to the device,' he said.",
"\n\nApple did not immediately respond to a request for comment.",
"\n\nOperating systems from iOS 10 to iOS 12 were targeted in the hack, which was able to access users' apps including Instagram, WhatsApp and Gmail. ",
"Google said it reported the security issues to Apple on February 1. ",
"Apple then released an operating system update on February 7\n\nApple's iOS is considered one of the most secure operating systems available because both it and the devices it runs on are built and managed by Apple – with little chance for gaps to appear between hardware and software that could be exploited by hackers.",
"\n\nThe general security of the technology giant's devices has also previously placed it at odds with intelligence services in the US.",
"\n\nApple was involved in a stand-off with the FBI in 2016 over access to the phone of a terror suspect in the San Bernardino shooting in California.",
"\n\nThe FBI had asked Apple to create a software 'back-door' to get around the phone's security settings and access data on the suspect's iPhone, but the tech firm refused.",
"\n\nApple argued that overall user privacy was paramount and that creating a back-door to its software could place all iPhone users at risk should the tool ever fall into the wrong hands."
] |
{
"pile_set_name": "OpenWebText2"
}
|
[
0.0070921985815602835,
0.012195121951219513,
0.023622047244094488,
0.0041841004184100415,
0,
0.04,
0.029411764705882353,
0.016129032258064516,
0,
0,
0,
0.01834862385321101,
0.02054794520547945,
0.014492753623188406,
0,
0,
0.006578947368421052,
0,
0,
0.006535947712418301,
0,
0,
0.02040816326530612,
0.029411764705882353,
0.009433962264150943,
0,
0.006802721088435374,
0.01764705882352941,
0
] | 0.009753
| 5
|
[
"Boris Sohn\n\nBoris Voelfovitsj Sohn (; 10 [25] January 1898, Syzran — 10 June 1966, Leningrad) was a Soviet stage actor, theatre director and theatre educator. ",
"He was made an Honoured Artist of the RSFSR in 1934.",
"\n\nReferences\n\nExternal links\nhttp://seance.ru/blog/zon-school/\nhttp://seance.ru/blog/shkola-borisa-zona/\nhttp://www.5-tv.ru/video/501775/\n\nCategory:Soviet male stage actors\nCategory:Soviet theatre directors\nCategory:Honored Artists of the RSFSR\nCategory:People from Syzran\nCategory:Performing arts education in Russia\nCategory:1898 births\nCategory:1966 deaths\nCategory:Soviet Jews"
] |
{
"pile_set_name": "Wikipedia (en)"
}
|
[
0.012578616352201259,
0.019230769230769232,
0.010526315789473684
] | 0.014112
| 5
|
[
"Today, Merry Christmas to Comcast! ",
"You’re welcome!",
"\n\nNo waiting until Christmas on Monday. ",
"Comcast, you obviously consider yourself too powerful.",
"\n\nToday, your hard-earned rate hikes take effect. ",
"Santa says you’ve been such a good company this year, only getting me concerned and wasting my time by forgetting when my Xfinity introductory offer ends.",
"\n\nComcast notice, page 1 of 7Comcast notice, page 2 of 7\n\nDoes anyone reading this have suggestions for me for when that offer actually does expire? ",
"I need the internet (keeping net neutrality, which nobody is counting on Comcast to do), and pretty much the local and basic cable stations, especially news. ",
"Nothing special. ",
"None of the new programs I’ve read about but never seen. ",
"There are a lot of companies’ names that I’ve read about but never understood. (",
"See new information released today, below.)",
"\n\nSeems like I’ll be looking at something very different and unfamiliar, since my building doesn’t do Verizon’s Fios nor satellite.",
"\n\nComcast’s old logo, before the feds let it buy NBC/Universal — under several conditions.",
"\n\nComcast, I know costs go up but Philadelphia is your hometown, you have more to lose here than elsewhere and here, you actually own so much of your own programming and channels, including one for local sports fans (now called NBC Sports Philadelphia) and two broadcast, over the public’s airways.",
"\n\nSIDEBAR: Looking at NBC10’s website, I noticed the Channel 10 homepage weather featured “StormTracker4” and thought that was weird. ",
"NBC also owns its station in the next city up: WNBC-4 in New York. ",
"WNBC also brands its homepage weather “StormTracker4” but that makes sense, since it’s Channel 4!",
"\n\nSo I tried another NBC-owned station that’s not on Channel 4 (anymore): WTVJ-6 in Miami. ",
"Their homepage weather is called “First Alert Doppler 6000” which makes sense for Channel 6 and is different from NBC’s two northern stations that are bigger, have different channel numbers, but the same name (at least at this moment). ",
"I wonder if this is regular or something simply went wrong.",
"\n\nANOTHER SIDEBAR: Newswise today, I noticed NBC10 beat Philadelphia competitor WTXF-Fox 29 (where I worked, 2016-2017) that had two headlines way up above the fold that were known and could’ve been written long ago — seven months and 15 months ago, respectively. ",
"Their personnel decisions should be going under the microscope.",
"\n\nYour guess why a May 12 Associated Press article had to be updated Dec. 20 is as good as mine. ",
"I don’t know what’s new or corrected from May 12.",
"\n\nSecond, a year and a half ago, in June 2016, I had trouble inserting my subway token at the Broad Street Subway’s Spring Garden station. ",
"There was no place to insert it. ",
"I ended up having to walk up and down steps at three of the four corners of that intersection to finally find a human to take my token and let me down to the train platform. ",
"So we knew tokens were being phased out. ",
"Besides, how many other cities already did away with them?",
"\n\nSIDEBAR OVER: So Comcast/Xfinity, for now, Merry Christmas, but I don’t know how long my even more costly business with you will last. ",
"We’ll have to find out if and when our relationship changes in the future. ",
"I can’t wait to see (with my own eyes) what you propose.",
"\n\nI also wonder, did @PHLCouncil, and especially my district’s @Darrell_Clarke, who happens to be city council president, allow your rate hike?",
"\n\nP.S. Readers probably figured out I had the Comcast portion of this blog post prepared since shortly after I got my bill (and read it) weeks ago. ",
"Coincidentally, I found several other articles on similar topics with updates and possible solutions, this morning alone!",
"\n\nFirst, The New York Times‘ “How to cut the cord on cable” which prepares us to use the internet and streaming services to save a ton of money. ",
"Our viewing habits are different, so we all should read it.",
"\n\nThird, the fighting between station owners, and cable/satellite operators, for retransmission consent money that probably cost you from watching something you wanted at some point (with both sides blaming each other) continues.",
"\n\nFinally, Bloomberg warns, “Cable TV’s password-sharing crackdown is coming” and “it’s a growing problem that could cost pay-TV companies millions of subscribers — and billions of dollars in revenue.",
"”The article reports TV Everywhere, started in 2009, “was an attempt to appeal to young consumers by letting them access cable or satellite shows on any device.” ",
"Of course, that “any device” part led to piracy and password-swapping since companies like Charter/Spectrum only force paying customers to enter their passwords for each device once a year. ",
"Somehow, tens of thousands watched just one subscriber’s streams simultaneously for free!",
"\n\nAnyway, after all that, got a solution for my Comcast concern? ",
"I’d love to hear in a comment! (",
"Got a web link?) ",
"And thanks!"
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0.02857142857142857,
0,
0,
0,
0,
0.006493506493506494,
0,
0,
0,
0,
0,
0,
0.007633587786259542,
0.011111111111111112,
0.003355704697986577,
0.014925373134328358,
0.014925373134328358,
0.020618556701030927,
0.02197802197802198,
0.00847457627118644,
0,
0.007575757575757576,
0,
0.010309278350515464,
0,
0,
0,
0,
0,
0,
0.014598540145985401,
0,
0,
0.013986013986013986,
0.006756756756756757,
0,
0.006896551724137931,
0,
0,
0.005,
0,
0.005263157894736842,
0,
0,
0,
0,
0
] | 0.004436
| 5
|
[
"Even though most Americans have consistently said government workers have it easier and get paid more than those in the private sector, a plurality wouldn’t want them to lose their jobs.",
"\n\nA new Rasmussen Reports national telephone survey finds that 32% of American Adults think it would be good for the economy if the federal government lays off 100,000 workers. ",
"Forty-seven percent (47%) say a layoff like that would be bad for the economy, while another 10% feel it would have no impact. ",
"Ten percent (10%) more are not sure. (",
"To see survey question wording, click here.)",
"\n\nThe survey of 1,000 Adults was conducted on June 12-13, 2012 by Rasmussen Reports. ",
"The margin of sampling error is +/- 3 percentage points with a 95% level of confidence. ",
"Field work for all Rasmussen Reports surveys is conducted by Pulse Opinion Research, LLC. ",
"See methodology."
] |
{
"pile_set_name": "OpenWebText2"
}
|
[
0,
0.005649717514124294,
0,
0,
0,
0.011764705882352941,
0,
0.03333333333333333,
0
] | 0.005639
| 5
|
[
"High speed free online web proxy\n\nIf your browser will use http referer - it will make online proxy surfing more correct, this proxy hiding real referer.",
"\n\nYou can also use fast access method \"http://proxy.my-addr.com/YOUR_URL\" for free proxy surfing.",
"\n\nWe advice to use Just put your url to text field and click \"START\". ",
"This proxy is free for use, but forbidden for bots or non human use.",
"If your browser will use http referer - it will make online proxy surfing more correct, this proxy hiding real referer.",
"You can also use fast access method \"http://proxy.my-addr.com/YOUR_URL\" for free proxy surfing.",
"We advice to use http proxy or http proxy with antivirus scan , it's cheap anonymouse private dedicated personal proxy. ",
"Advanced settings User-Agent: --real-- --do not use-- Explorer 8 Explorer 9 FireFox 48 Chrome 52 Opera Safari Google Bot Show navigation bar Clean cookies before start Turn off cookies Turn off scripts My-Addr Project do not steal your accounts and do not store your data ! ",
"Biggest part of other proxies doing it! ",
"SSL/HTTPS connection compatible\n\nGoogle/Yahoo/Bing search compatible\n\nLivejournal, Facebook mobile, Gmail basic Fast upload speed\n\n60 seconds timeout\n\nFull error output Free for use\n\nNo daily limits\n\nNo requests logs My-Addr Project online web proxy that do not save any content, it is just trasfering data from requested site to customer, so it is not copyright infringement or phishing. ",
"Online proxy surf is legal and do not break any laws or rules.",
"\n\nIf you webmaster and you do not want that customers see your content - do not share it in Internet!",
"\n\nMake us know if something is broken or for contact us use email address help(*)my-addr.com. ** ",
"all bots are fobidden and will be banned permanent Continue with My Personal Anonymous HTTP Proxy or HTTP Proxy with AntiVirus scan"
] |
{
"pile_set_name": "OpenWebText2"
}
|
[
0,
0.010309278350515464,
0,
0,
0,
0.010526315789473684,
0,
0,
0,
0.005141388174807198,
0,
0,
0,
0.007633587786259542
] | 0.002401
| 5
|
[
"---\nabstract: 'Efficient coupling between on-chip sources and cavities plays a key role in silicon photonics. ",
"However, despite the importance of this basic functionality, there are few systematic design tools to simultaneously control coupling between multiple modes in a compact resonator and a single waveguide. ",
"Here, we propose a large-scale adjoint optimization approach to produce wavelength-scale waveguide–cavity couplers operating over tunable and broad frequency bands. ",
"We numerically demonstrate couplers discovered by this method that can achieve critical, or nearly critical, coupling between multi-ring cavities and a single waveguide at up to six widely separated wavelengths spanning the $560$–$1500$ nm range of interest for on-chip nonlinear optical devices.'",
"\nauthor:\n- Weiliang Jin\n- Sean Molesky\n- Zin Lin\n- 'Kai-Mei C. Fu'\n- 'Alejandro W. Rodriguez'\ntitle: Inverse Design of Compact Multimode Cavity Couplers\n---\n\nPractical limitations of nanophotonics for broadband applications are seldom known and highly context specific [@Yu10; @miller2015shape; @arabi17]. ",
"In single frequency problems, traditional design principles based on index-guiding, Bragg scattering, and material resonances offer clear trade offs, e.g., spatial confinement for radiative losses, or peak performance for bandwidth. ",
"But, in many multi-frequency problems, including nonlinear optics [@sitawarin2017inverse; @li2016efficient], imaging [@sell2017large; @callewaert2018inverse], radiative heat transfer [@jin2017overcoming; @jin2018frequency], and optical networks [@miller2017silicon], the number of parameters that influence performance is simply too large to treat completely using analytic methods or hand-designed geometries, and it is often unclear what level of performance can be attained. ",
"Over the last two decades, this challenge has spurred the development of large-scale optimization (inverse) techniques to assist in the design process with promising early returns [@jensen2011topology; @jlu_oe2013; @lalau-keraly_oe2013]. ",
"Yet, in many technically important areas only preliminary investigations have been made [@molesky2018outlook]. ",
"Specifically, the power required to attain efficient nonlinear frequency conversion processes is known to decrease with increasing spatial confinement, so long as the overlap of the participating modes can be controlled [@rodriguez2007chi]. ",
"To take full advantage of this effect, we have recently proposed several optimized resonators to enhance nonlinear second harmonic and difference frequency generation in wavelength-scale volumes [@lin2016cavity; @lin2017topology]. ",
"To operate on-chip, each mode in a device making use of these cavities must be coupled to a source or detector in a controlled way; and until presently, we have not addressed how this can be done. ",
"Using a typical evanescent scheme, tuning the gap separation to control evanescent overlap between the waveguide and cavity [@chandrahalim2017evanescent], realization of high efficiency devices using these cavities, and similar future designs, may be difficult. ",
"Beyond the issues of layout intricacy, bending loss [@vlasov2004losses; @fujisawa2017low], and waveguide crosstalk [@donzella2013study; @jahani2015photonic] that would be introduced by requiring multiple waveguides to intersect in a wavelength-scale area, modes in the best performing cavities designs may be tightly confined to the core [@lin2017topology], precluding the possibility of achieving critical or over coupling by simply decreasing the separation.",
"\n\nThis problem of efficiently coupling light between sources and predefined volumes appears in many branches of nanophotonics. ",
"For instance, it is the defining goal of wide-area absorbers—surfaces that can perfectly absorb a wide range of incident propagating waves. ",
"Broadly, the main approach in this setting is to create structures supporting many resonances in order to tune the radiative and absorptive decay rates in each scattering channel[@ghebrebrhan2011tailoring]. ",
"This behaviour can be introduced in a wide variety of ways, including adiabatic tapers [@wu2016broadband; @lin2017tungsten], metasurfaces [@argyropoulos2013broadband; @liu2017experimental], epsilon-near-zero thin films [@molesky2013high; @rensberg2017epsilon], chirped gratings [@song2013near; @ji2014broadband], multi-resonant photonic crystals [@rinnerbauer2014superlattice], and more recently, unintuitive structures obtained via inverse design [@ganapati2014light; @sui2015topology; @fu2016broadband]. ",
"A similar objective also appears in the context of free-space to on-chip couplers, with the primary aim being to reduce losses, i.e. reflections, of light incident on a on-chip device from either a fiber or free space. ",
"Rate matching is more difficult to implement in these situations, as any signal decay (e.g. material absorption in the coupling region) reduces performance; and common approaches based on adiabatic tapers lead to couplers that are several wavelengths long and are only typically designed to operate over narrow, selective bands [@almeida2003nanotaper; @carmon2007wavelength; @fu2014efficient; @tiecke2015efficient]. ",
"Based on motivations similar to those of this present study, there is a current push to exploit inverse design [@niederberger2014sensitivity; @mansoor2017optimization], metasurface concepts [@zhu2017very; @li2017controlling; @li20182], and chaotic deformations [@jiang2017chaos] in this area. ",
"Likewise, a need to control coupling arises between on-chip devices, including filters, rectifiers, multiplexers, and frequency converters. ",
"In these situations, the usual goal is to efficiently couple two or more separately designed devices in the smallest possible footprint. ",
"Again, much in the spirit of the results presented here, within the past few years inverse design approaches have started to be applied in this setting, leading to experimental demonstrations of compact wavelength-division mulitplexers operating over several far-apart wavelengths [@piggott2015inverse; @frellsen2016topology].",
"\n\nIn this paper, we present a large-scale optimization algorithm for designing compact on-chip devices that efficiently couple light consisting of multiple, widely separated wavelengths from a single waveguide into a wavelength-scale multi-resonant cavity. ",
"Motivated by practical problems in nonlinear optics, we pursue three illustrative examples: compact multi-resonant cavities with resonant features mimicking those used for second-harmonic, sum-frequency, and frequency comb generation. ",
"In each situations, we demonstrate either total or near total critical coupling.",
"\n\n{width=\"0.6\\columnwidth\"}\n\n*Formulation.—* ",
"Our conception of the coupling problem is depicted in Fig.",
" 1. ",
"Starting from an isolated cavity supporting $N$ resonances with frequencies $\\omega_i$ and radiative lifetimes $Q^0_{i,r}$, $i = \\{1,2,\\cdots, N\\}$, we aim to design a wavelength-scale device that tunes the external coupling rate of each mode to a single nearby waveguide to any desired value. ",
"That is, we seek to independently control the dimensionless coupling quality factor $Q_{i,c}$ of every individual mode of a given set. ",
"Generically, the presence of a coupler or a nearby waveguide can significantly alter the radiative decay of an isolated cavity modes, either enhancing or degrading temporal confinement. ",
"To ensure that the resonant features of the cavity are not destroyed by the coupler, we simultaneously constrain $Q_{i,r}^0\\leq Q_{i,r}\\alpha_{i}$, with $Q_{i,r}$ denoting the radiative quality factor of the cavity in the presence of the waveguide and coupler, and $\\alpha_{i}$ an adjustable scale factor. ",
"Based on this description, a structure for any desired collection of coupling characteristics is discoverable using a gradient adjoint-variable topology optimization approach [@liang2013formulation] that seeks to solve the minimax problem, $$\\begin{aligned}\n &\\min_{\\{\\bar{\\varepsilon}\\}} \\mathcal{F}(\\mathbf{E},\\bar{\\varepsilon})\\\\\n \\text{s.t.}\\;\\;&\\{\n \\mathcal{G}_i(\\mathbf{E},\\bar{\\varepsilon})\\leq 0\\},\\;\n i=1,2,\\cdots, N\\nonumber\\\\\n & \\varepsilon_{\\text{sub}}\\leq \\bar{\\varepsilon}\\leq\n \\varepsilon_{st},\\nonumber\\end{aligned}$$ where $$\\begin{aligned}\n &\\mathcal{F}(\\mathbf{E},\\bar{\\varepsilon})= \\max_{i=1}^N\\left[ Q_{i,c}(\\mathbf{E},\\bar{\\varepsilon})-\\xi_iQ_{i,r}(\\mathbf{E},\\bar{\\varepsilon}) \\right]^2\n \\label{eq:constraints}\\\\\n &\\mathcal{G}_i(\\mathbf{E},\\bar{\\varepsilon})=Q_{i,r}^0-\\alpha_iQ_{i,r}(\\mathbf{E},\\bar{\\varepsilon}),\\nonumber\\end{aligned}$$ with $\\xi_i$ denoting the target ratio of $Q_{i,c}/Q_{i,r}$. In this method, the dielectric permittivity at every spatial point inside the coupling region, $\\{\\bar{\\varepsilon}\\}$, is as a continuous degree of freedom, bounded by the substrate $\\varepsilon_{\\text{sub}}$ and structure $\\varepsilon_{\\text{st}}$ materials. (",
"To produce binary, smooth, fabricable systems additional regularization and filter projection steps are applied in conjunction with this base algorithm [@wang2011projection].) ",
"In order to circumvent numerical issues associated with optimizations of electromagnetic eigenvalues [@liang2013formulation], each $Q$ is computed by solving a set of scattering problems. ",
"This makes both the objective $\\mathcal{F}$ and constraints $\\mathcal{G}_{i}$ explicit functions of the electric field $\\mathbf{E}$, computed as the solution of the steady-state equation $\\left[ \\nabla\\times\n \\frac{1}{\\mu}\\nabla\\times-\\omega_i^2\\varepsilon(\\omega_i,\\mathbf{r})\\right]\\mathbf{E}(\\omega_i,\\mathbf{r})=i\\omega\n\\mathbf{J}(\\omega_i,\\mathbf{r})$. To setup this problem, electric current sources, the duals $\\mathbf{J}\\left(\\omega_{i}\\right)\\propto\\text{Re}\\left[\\epsilon\\left(\\omega_{i}\\right)\\right]\n\\mathbf{E}^{*}\\left(\\omega_{i}\\right)$ of the modes in the energy norm [@chembo2010modal], are first calculated (without the waveguide and coupler) at each individual frequency. ",
"The waveguide and coupler are then added, and the field quantities of interest determined: the electromagnetic energy density inside the cavity volume, $U_i=\\frac{1}{2}\\int_{V}\\text{d}V\\varepsilon(\\omega_i,\\mathbf{r})|\\mathbf{E}(\\omega_i,\\mathbf{r})|^2$, and the Poynting flux into the waveguide and radiated into vacuum, $P_{i}=\\frac{1}{2}\\int_{\\Sigma}\\text{d}\\mathbf{s}\\cdot\\mathrm{Re}[\\mathbf{E}(\\omega_i,\\mathbf{r})^{*}\\times\n\\mathbf{H}(\\omega_i,\\mathbf{r})]$, with $\\Sigma$ denoting the corresponding flux surfaces. ",
"The radiative and coupling lifetimes $Q_{i,c(r)}=\\omega_iU_i/P_{i,c(r)}$ are then used to evaluate $\\mathcal{F}$ and $\\mathcal{G}_{i}$.\n\nIn many applications of interest, one of two coupling characteristics are often desired: over coupling [@guo2016chip; @pfeiffer2017coupling], minimizing unwanted losses and increasing energy efficiency, or critical coupling, maximizing field amplitudes in the cavity [@lin2016cavity]. ",
"For cavities designed to enhance nonlinear frequency conversion, such as the illustrative examples considered below, maximum power conversion occurs under critical coupling, $\\xi_i=1$, at each frequency. ",
"In such cases, the general scheme presented above can be simplified. ",
"When the cavity is pumped from a single channel with power $P^{\\text{in}}$, the energy in the cavity is related to the quality factors by [@suh2004temporal] $$\\frac{\\omega_i\\;U_i}{P^{\\text{in}}_i}=\\frac{4\\;Q_{i,r}}{\n 2+Q_{i,r}/Q_{i,c}+Q_{i,c}/Q_{i,r}},\n\\label{eq:U}$$ reaching a relative maximum of $Q_{i,r}$ as the system moves toward critical coupling ($\\xi_i\\rightarrow 1$). ",
"Technically, [(\\[eq:U\\])]{} is only applicable to unidirectional couplers, i.e. when each cavity mode couples only to one port (direction) of the waveguide. (",
"A simple example of a unidirectional coupler is the usual waveguide–ring resonator system, where the direction of coupling is constrained by momentum conservation [@gorodetsky1999optical].) ",
"However, as the introduction of any additional coupling channel always reduces the energy stored in the cavity [@suh2004temporal], in practice, there is no loss of generality in considering this expression. ",
"By maximizing the energy in the cavity, the algorithm naturally proceeds towards unidirectional couplers, which in turn makes [(\\[eq:U\\])]{} an increasingly good approximation. ",
"Since the behavior of [(\\[eq:U\\])]{} is then ultimately equivalent to the more complicated [(\\[eq:constraints\\])]{}, we are able to consider the simpler optimization problem, $$\\mathcal{F}'(\\bar{\\varepsilon})=\\max_{\\bar{\\varepsilon}}\\left\\{\\min_{i=1}^N \\left[\\frac{U_i(\\mathbf{E},\\bar{\\varepsilon})}{U_i^0} \\right]\\right\\}.",
"\n\\label{eq:Uopt}$$ Where the $U_i^{0} = Q_{i,r}^0 P_i^{\\text{in}}/\\omega_i$ is an energy normalization factor given by the bare radiative lifetime.",
"\n\n{width=\"1.8\\columnwidth\"}\n\nAs a proof of concept, we consider two illustrative cavities designed to enhance two $\\chi^{(2)}$ nonlinear processes: up-conversion of $\\omega_1$ and $\\omega_2$ to the summed frequency $\\omega_s=\\omega_1+\\omega_2$ (SFG), and second-harmonic generation (SHG) corresponding to degenerate SFG with $\\omega_1=\\omega_2$. For these processes, the relative coupling rates largely dictate the achievable intensities in the cavity, and hence power requirements (in the undepleted regime [@lin2016cavity]). ",
"Mathematically, this is captured by the figure of merit $$\\text{FOM} = |\\beta|^2\\prod_{i=1,2,s}\\frac{Q_{i,r}}{2+ Q_{i,r}/Q_{i,c}+Q_{i,c}/Q_{i,r}},\n \\label{eq:FOM}$$ with $\\beta$ denoting the overlap coefficient of the cavity fields, which to first order is not affected by the external waveguide or coupler. ",
"Like [(\\[eq:U\\])]{}, [(\\[eq:FOM\\])]{} is maximized when all three modes achieve critical coupling, giving $\\text{FOM}_\\text{max} = |\\beta|^2Q_{1,r}Q_{2,r}Q_{s,r}/64$.\n\n{width=\"1.8\\columnwidth\"}\n\n*Results.—* ",
"As a platform for testing our algorithm, similar to proposed wavelength-scale cavities for implementing nonlinear phenomena[@lin2017topology], we consider a two-dimensional system consisting of hand-designed multi-track ring-resonators supporting TM-polarized resonances of moderate radiative lifetimes $Q_{i,r}^0\\lesssim 10^5$, and a rectangular admissible coupler region covering the separation between the cavity and the waveguide. ",
"The size of this design region is determined on a case-by-case basis as a compromise between compactness and functionality. ",
"Starting from a base of 3.75 $\\mu$m $\\times$ 1.5 $\\mu$m the size of the coupling region is increased whenever the algorithm is unable to find suitable coupling structures. ",
"To guide the algorithm towards more easily fabricable structures, the coupler is always seeded with connected, smooth dielectric profiles, i.e. a random ribbon. (",
"For numerical accuracy, the grid resolution is chosen to be smaller than $\\lambda / 45$ for the smallest wavelength considered, $\\approx 13$ pixels per wavelength inside the highest index media.)",
"\n\nOur findings begin with the SHG and SFG systems depicted Fig.",
" 2. ",
"For practical considerations, these simulations suppose a gallium phosphide material (including material dispersion) for all dielectric regions: the cavity, waveguide, and coupler. ",
"The initial SHG system is a two-track multi-ring supporting TM-polarized resonances at $\\lambda_{\\left\\{1,s\\right\\}}=\\left\\{1500,\\;750\\right\\}$ nm, quality factors of $Q^0_{\\{1,s\\},r} = \\{1.4,4.6\\}\\times 10^3$, with power coupled into the device through a narrow waveguide at a gap separation of 1.5$\\lambda_1$. (The azimuthal numbers of these modes satisfy the phase-matching condition $m_s=2m_1=16$ for the (111) plane of a GaP crystal. ",
"Given a different nonlinear tensor and requisite polarizations, the phase-matching condition for $m$ can be slightly different [@bi2012high].) ",
"As indicated in the field profiles of Fig. ",
"2 (a), in the presence of the coupler each mode shows vanishing transmission and reflection ($\\lesssim 2\\%$), and large field amplitude inside the cavity. ",
"Quantitatively, Fig. ",
"2 (a) (rightmost) examines the energy spectrum inside the resonator channeled from the waveguide around $\\lambda_{1,2}$, normalized by $U_i^0$. After optimization, the cavity mode lifetime is more than doubled, with $Q_{\\left\\{1,s\\right\\},r}/Q_{\\left\\{1,s\\right\\},r}^0=\\left\\{2.9,\n 2.2\\right\\}$. As expected, eigenmode analysis reveals the system to be totally asymmetric, with the cavity coupling exclusively to the lower waveguide (downwards propagation). ",
"The coupler is also observed to be both binary and smooth, having no feature smaller than $120$ nm. ",
"Nearly identical results are seen for the triply resonant system (non-degenerate SFG) illustrated in Fig.",
" 2 (b). ",
"Moving to a three-track cavity designed to support modes at $\\lambda_{\\{1,2,s\\}}=\\{1500,\\;907,\\;565\\}$ nm, with $Q_{\\{1,2,s\\},r}^0=\\left\\{640,\\;5.3\\times 10^4,\\; 3.2\\times\n 10^4\\right\\}$, the algorithm is again able to realize critical coupling at all three wavelengths, resulting in transmission $\\lesssim 1\\%$. Cavity radiative lifetimes are also similarly enhanced, with $Q_{\\left\\{1,2,s\\right\\},r}/Q_{\\left\\{1,2,s\\right\\},r}^0=\\left\\{2.2,\\;1.7,\\;3.1\\right\\}$. In either inverse design, the coupling mechanism is found to be more intricate than just the overlap of evanescent fields used for single wavelengths. ",
"This is most pointedly seen in (2) and (3) of Fig.2 (b), where over $99.5$% of the energy density is in the cavity, yet critical coupling occurs at over two wavelength of separation due to the fields in the coupler. ",
"Moreover, for some cavity modes, even at a single wavelength, it would not be possible to achieve critical coupling using the evanescent tails of a waveguide mode. ",
"For example, due to its tight confinement to the inner ring, even if the waveguide is made to touch the cavity, it is not possible to couple to the mode displayed in Fig. ",
"2 (a.1) with better than $70\\%$ efficiency. (",
"Reducing the waveguide cross-section offers no improvement due to the creation of phase mismatch.) ",
"Note that the radiative quality factors of the cavities we have designed are smaller than those typically considered for nonlinear processes. ",
"This choice was made primarily to test the algorithm in cases involving dissimilar waveguide and cavity mode profiles [@xu2008silicon]. ",
"Nevertheless, we note that for equivalent nonlinear performance, larger overlaps $\\beta$ and smaller radiative lifetimes are often preferable to higher quality factors [@lin2016cavity].",
"\n\nAs a final benchmark, Fig. ",
"3 demonstrates a system attaining near critical coupling at 6 frequencies (over an octave), a frequency comb with large tooth spacing. (",
"A more practical frequency comb coupler, e.g. exhibiting critical coupling at over $100$ frequencies, will be considered in future work.) ",
"In this case, we begin with a wavelength-scale ring resonator having unevenly distributed modes $m=\\{5\\rightarrow 10\\}$ at intervals $\\Delta f=\\{0.101, 0.099, 0.096, 0.098, 0.096\\}\\mathrm{c}/1.5\\mu$m, with $f_{m}=0.667c/\\left(1.5\\mu\\text{m}\\right)+\\sum^{m-5}_{i=0} \\Delta\nf_{i}$. To simplify future comparisons, material dispersion is ignored and the cavity, waveguide and coupler are all assumed to have a constant permittivity of $\\varepsilon=9.3514$. As opposed to our first two examples, where the modal resonance frequencies are fixed constraints, adding a degree of modularity to the total system design, here, we assume that the resonance frequencies must be tuned by the coupler. ",
"This conceptual shift requires some small modifications to stabilize the optimization algorithm. ",
"Namely, we now include an initial phase where the usual energy density objectives are replaced by field overlap integrals with the eigenmodes of the cavity $\\int_{V}\\text{d}V\\;\\text{Re}\\left[\\varepsilon(\\omega_i,\\mathbf{r})\\mathbf{E}^{*}_{m}(\\omega_i,\\mathbf{r})\\cdot\\mathbf{E}(\\omega_i,\\mathbf{r})\\right]$, where the $m$ subscript denotes the $m^{th}$ mode of the bare cavity, and, as before, the integration is restricted to lie within the outermost material boundary of the cavity. ",
"The frequencies $\\left\\{\\omega_{i}\\right\\}$ where these computations are carried out are initialized to match those of the bare cavity, and then slowly transitioned to the desired resonances, i.e. an evenly distributed set. ",
"The converged output of this procedure is effectively a new cavity having characteristics well-matched to the original coupling optimization algorithm. ",
"The coupler displayed in Fig.",
" 3 achieves the desired wavelength tuning and critical-coupling functionality. ",
"The resonance frequency intervals are equally distributed as $\\Delta f=0.098 \\mathrm{c}/1.5 \\mu$m, and good coupling (transmission and reflection below $15\\%$) is visibly present in each of the field profile plots. ",
"Explicitly, the summed transmitted and reflected powers of are found to be $\\left\\{2\\%,~5\\%,~13\\%,~2\\%,~1\\%,~4\\%\\right\\}$. However, smaller minimal feature sizes, $\\approx 15$ nm, and a larger total footprint $4.5~\\mu\\text{m} \\times 4.5~\\mu\\text{m}$ were required to achieve these effects. ",
"The number of iterations needed for this optimization was roughly the same as those of the previous examples, leading to approximately linearly scaling of the total computation time with the number of frequencies. ",
"In summary, we have shown that, in two dimensions, inverse design provides a practical means of efficiently coupling light at multiple widely separated wavelengths from a single channel (a waveguide) into a compact, multimode cavity. ",
"Drawing from our recent work on the design of compact microcavities for high-efficiency nonlinear frequency conversion, we have successfully treated suggestive examples for second-harmonic (SHG), sum-frequency (SFG), and frequency comb generation (albeit for large tooth spacing). ",
"Critical coupling was achieved, or nearly achieved, at all relevant wavelengths without incorporating sharp components in the first two cases. ",
"In particular, all features of the SHG system are larger than $120$ nm. ",
"Our results continue the promising trend seen in application of inverse design to free-space and on-chip couplers, rectifiers, and multiplexers, indicating the potential of these techniques to enable significant improvements in integrated nonlinear photonics.",
"\n\n*Acknowledgments.—* ",
"This work was supported by the National Science Foundation under Grant No. ",
"DMR-1454836, Grant No. ",
"DMR 1420541, and Award EFMA-1640986; and the National Science and Research Council of Canada under PDF-502958-2017.",
"\n\n[56]{}ifxundefined \\[1\\][ ifx[\\#1]{} ]{}ifnum \\[1\\][ \\#1firstoftwo secondoftwo ]{}ifx \\[1\\][ \\#1firstoftwo secondoftwo ]{}““\\#1””@noop \\[0\\][secondoftwo]{}sanitize@url \\[0\\][‘\\\n12‘\\$12 ‘&12‘\\#12‘12‘\\_12‘%12]{}@startlink\\[1\\]@endlink\\[0\\]@bib@innerbibempty @noop [****, ()]{} @noop [****, ()]{} @noop [**** ()]{} @noop [ ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [ ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [ ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} in @noop [**]{}, Vol.",
" (, ) p. @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [**** ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [ ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{} @noop [****, ()]{}\n"
] |
{
"pile_set_name": "ArXiv"
}
|
[
0,
0,
0,
0,
0.0196078431372549,
0.004291845493562232,
0.0041841004184100415,
0.008403361344537815,
0,
0,
0.008658008658008658,
0,
0,
0.006521739130434782,
0,
0,
0.004830917874396135,
0.01383399209486166,
0,
0.004807692307692308,
0.010238907849829351,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0.017241379310344827,
0,
0,
0,
0,
0.0032679738562091504,
0.00333889816360601,
0,
0,
0.001447178002894356,
0,
0.0071090047393364926,
0,
0,
0.002638522427440633,
0,
0,
0.004830917874396135,
0,
0,
0.006802721088435374,
0,
0.0055248618784530384,
0,
0.0058823529411764705,
0,
0.0022988505747126436,
0,
0,
0,
0,
0.031746031746031744,
0,
0,
0.002277904328018223,
0.006993006993006993,
0.023255813953488372,
0,
0.047619047619047616,
0,
0,
0.009523809523809525,
0,
0.0016233766233766235,
0,
0,
0.005847953216374269,
0,
0,
0,
0.007352941176470588,
0.005405405405405406,
0.034482758620689655,
0,
0,
0.0014534883720930232,
0,
0,
0,
0,
0.034482758620689655,
0,
0,
0,
0,
0,
0.0035587188612099642,
0,
0,
0,
0,
0.013333333333333334,
0,
0.02608695652173913,
0.037993920972644375,
0.04992867332382311
] | 0.004611
| 5
|
[
"Campo Santo, Salta\n\nCampo Santo (Salta) is a town and municipality in Salta Province in northwestern Argentina.",
"\n\nReferences\n\nCategory:Populated places in Salta Province"
] |
{
"pile_set_name": "Wikipedia (en)"
}
|
[
0.018018018018018018,
0
] | 0.009009
| 5
|
[
"Q:\n\nCard and Deck classes\n\nI would like to know whether I'm going in a correct way or not in building my Poker game. ",
"So far, I've implemented card and deck classes and I would like to see your feedback about my work. ",
"Feel free to criticize the code of any regard (organization, order, comments ... etc) \ncard.h \n#ifndef CARD_H\n#define CARD_H\n\n#include <string>\n\nconst int SUIT_MAX(4);\nconst int RANK_MAX(13);\n\nclass Card\n{\n friend class Deck; // Deck Class needs to access to Card Class but not vice versa\npublic:\n explicit Card();\n explicit Card(const int &suit, const int &rank);\n\n std::string Card2Str() const;\n\nprivate:\n int generate_suit();\n int generate_rank();\n int get_suit() const;\n int get_rank() const;\n int m_suit;\n int m_rank;\n};\n#endif\n\ncard.cpp\n#include <stdlib.h> /* srand, rand */\n#include \"card.h\"\n#include <iostream>\n\nconst std::string SUIT[SUIT_MAX] = {\"S\", \"H\", \"D\", \"C\"};\nconst std::string RANK[RANK_MAX] = {\"2\",\"3\",\"4\",\"5\",\"6\",\"7\",\"8\",\"9\",\"10\",\"J\",\"Q\",\"K\",\"A\"};\n\nCard::Card()\n{\n m_suit = generate_suit(); \n m_rank = generate_rank();\n}\n\nCard::Card(const int &suit, const int &rank) : m_suit(suit), m_rank(rank)\n{\n\n}\n\nint Card::generate_suit()\n{\n return rand() % (SUIT_MAX-1) + 0;\n}\n\nint Card::generate_rank()\n{\n return rand() % (RANK_MAX-1) + 0;\n}\n\nstd::string Card::Card2Str() const\n{\n return SUIT[get_suit()] + RANK[get_rank()];\n}\n\nint Card::get_suit() const\n{\n return m_suit;\n}\n\nint Card::get_rank() const\n{\n return m_rank;\n}\n\ndeck.h\n#ifndef DECK_H\n#define DECK_H\n\n#include <vector>\n#include <iostream>\n#include <fstream>\n#include \"card.h\"\n\nusing namespace std;\n\nclass Deck\n{ \npublic:\n explicit Deck();\n void print_Deck() const;\n void getOneCard();\nprivate:\n std::vector<Card> m_deck;\n\n};\n\n#endif\n\ndeck.cpp\n#include <iostream>\n#include \"deck.h\"\n\nDeck::Deck()\n{\n for (unsigned int i(0); i < SUIT_MAX; ++i)\n {\n for (unsigned int j(0); j < RANK_MAX; ++j)\n {\n Card card(i, j);\n m_deck.push_back(card);\n }\n }\n}\n\nvoid Deck::print_Deck() const\n{\n unsigned int count(1);\n\n for (unsigned int i(0); i < m_deck.size(); ++i)\n {\n std::cout << m_deck[i].Card2Str() << \" \";\n if ( count == 13 )\n {\n std::cout << std::endl;\n count = 0;\n }\n ++count;\n }\n}\n\nvoid Deck::getOneCard()\n{ \n Card cd(m_deck.back().get_suit(), m_deck.back().get_rank());\n m_deck.pop_back();\n std::cout << cd.",
"Card2Str() << std::endl;\n}\n\nmain.cpp\n#include <iostream>\n#include <vector>\n#include <stdlib.h> /* srand, rand */\n#include <time.h> /* time */\n#include <string>\n\n#include \"card.h\"\n#include \"deck.h\"\n\nint main()\n{\n srand (time(NULL));\n\n Deck _deck; \n _deck.print_Deck();\n _deck.getOneCard();\n\n std::cout << std::endl;\n _deck.print_Deck();\n\n std::cout << std::endl;\n\n return 0;\n}\n\nA:\n\nPrefer nullptr to NULL if you're using C++11.",
"\n<stdlib.h> and time.h are both C libraries. ",
" Use the respective C++ libraries <cstdlib> and <ctime>. ",
" The rest are okay. ",
" You don't need to include <vector> in main.cpp.",
"\nSince you use a storage container for your deck, you can display it using iterators:\nfor (auto iter = m_deck.begin(); iter !",
"= m_deck.cend(); ++iter)\n{\n std::cout << *iter << \"\\n\";\n}\n\nIf you're using C++11, use a range-based for-loop:\nfor (auto& iter : m_deck)\n{\n std::cout << iter << \"\\n\";\n}\n\nI don't know why you're using randomness to generate a card within the class. ",
" The constructor should be given input to determine its rank and suit. ",
" A card shouldn't create itself, and you wouldn't want this with an actual card game. ",
" Remove the generate functions entirely, and instead allow the constructor to receive arguments to determine the card's value.",
"\nYou also don't need to construct the deck within its constructor. ",
" A deck can still start out empty until cards are passed to it. ",
" That should be handled in client code, especially if someone doesn't want a 52-card deck (or a certain game uses something different).",
"\nAs an alternative to using std::strings, consider enums for the ranks and suits:\n// make sure the first rank is explicitly set at 1\n// this will make the last rank equal 13\nenum Rank { Ace=1, Two, /* ... */, Queen, King };\n\nenum Suit { Spades, Hearts, Diamonds, Clubs };\n\nWith this, you'll no longer need the arrays nor the max constants. ",
" Your m_rank and m_suit members should also be one of these enum type (Rank and Suit respectively). ",
" The enums and the Card class declaration should all then be contained in a namespace.",
"\nWithin your card class, you'll need functions to convert a given enum value to a char value for displaying. ",
" You could, for instance, do this with a switch statement, which will serve as a look-up table. ",
" This will also make it easier to maintain the ranks and suits.",
"\nstd::string getRank(Rank rank)\n{\n switch (rank)\n {\n case Ace: return \"A\";\n // ...\n default: throw std::logic_error(\"invalid rank\");\n }\n}\n\n// same idea with suits\n\nAlso note the default statement. ",
" If an invalid rank is passed in, an std::log_error exception will be thrown. ",
" Regardless of what works best for error-handling, there should be a default statement here to properly handle it.",
"\nRename Card2Str() to CardToString(). ",
" The former is just awkward wording. ",
" It should also be lowercase as it's a function and not a type.",
"\ngetOneCard() doesn't specify where in the deck the one card is drawn. ",
" Since it takes a card from the top of the deck, just call it draw() or deal(). ",
" On the other hand, it's void and has no parameters, so it's not returning a card. ",
" If this is supposed to just display a top card, then it's ineffective as it's still destroying the top card.",
"\nBetter yet, consider having a draw() and a top() (perhaps you just need to peek at the top card). ",
" The functionality also looks a bit unclear. ",
" Since you're using std::vector, a storage container, make use of its member functions. ",
" In this case, use back():\ndraw():\nCard Deck::draw()\n{ \n Card cd = m_deck.back();\n m_deck.pop_back();\n return cd;\n}\n\ntop():\n// return by const& as this Card should only be read-only\n// also make the function const as no data members are modified\nCard const& Deck::top() const\n{ \n return m_deck.back();\n}\n\nFor both of these functions, be sure the caller is first checking for an empty deck.",
"\nSide-note: You can use a different storage container if you, say, need to be able to insert into or draw from somewhere else in the deck besides the top or bottom. ",
" For that, you can use an std::list (doubly linked list). ",
" If you instead want to insert into or draw from the top and bottom, you can use an std::deque (double-ended queue). ",
" Otherwise, stay with what you have.",
"\nYour deck is missing something: a shuffle function! ",
" You could utilize std::random_shuffle from the STL to do it nicely for you:\nvoid Deck::shuffle()\n{\n std::random_shuffle(m_deck.begin(), m_deck.end());\n}\n\nYou should also check for an empty deck prior to shuffling.",
"\n\nA:\n\nI come from Java world, but here are just a few thoughts:\n\ngenerate_suit and generate_rank methods should probably not subtract 1 from MAXes and also adding zero at the end is unnecessary. ",
"E.g. rand() % (SUIT_MAX-1) is rand() % 3 and this could never be 3, so you will never have generated clubs ♣.",
"\nFriending Card class by Deck class is not necessary. ",
"Just make get_suit and get_rank methods public and/or create a copy constructor of the Card class and/or rewrite getOneCard method like this:\nvoid Deck::getOneCard()\n{ \n std::cout << m_deck.back().Card2Str() << std::endl;\n m_deck.pop_back(); \n}\n\nCard::Card() constructor doesn't seem used now, so consider deleting it along with both generate* methods.",
"\n\nA:\n\nThis is probably overkill for a poker program, but if you wanted to reuse your Deck class for card games other than poker you'll need to decouple it from your Card class.",
"\nIn general, a Deck of cards is similar for all card games regardless of what type of cards are being used. ",
"Decks can be shuffled, cards can be drawn, etc.",
"\nCards however can be poker cards, pinochle cards, memory game cards, UNO cards, or many more, not all have suits or ranks, though they all may have some way to print or display whatever values they do contain.",
"\nWith that in mind, if you plan on making other card games besides poker, consider making an ICard abstract interface with some type of pure virtual display or print method, and having your Deck class depend on the interface instead of the Card class directly. ",
"Then you'll be able to perform Deck actions on any type of card for any type of card game you can dream up in the future. ",
"It will also mean that Deck should not be friends with any concrete Card class.",
"\nThis added complexity though is not necessary if you only plan to make a poker game.",
"\n\n"
] |
{
"pile_set_name": "StackExchange"
}
|
[
0.017094017094017096,
0,
0.006153846153846154,
0.002173913043478261,
0,
0,
0,
0,
0,
0.003952569169960474,
0,
0,
0,
0,
0,
0,
0.008823529411764706,
0.02,
0,
0,
0,
0,
0.004405286343612335,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0.0024691358024691358,
0,
0,
0,
0,
0,
0.004608294930875576,
0.010256410256410256,
0.009174311926605505,
0.037037037037037035,
0.002717391304347826,
0.005681818181818182,
0,
0,
0.004761904761904762,
0.007662835249042145,
0,
0.012658227848101266,
0,
0
] | 0.002902
| 5
|
[
"{\n \"author\": \"\",\n \"name\": \"serverstats\",\n \"version\": \"0.0.0\",\n \"repository\": {\n \"type\": \"git\",\n \"url\": \"git://github.com/einaros/ws.git\"\n },\n \"engines\": {\n \"node\": \">0.4.0\"\n },\n \"dependencies\": {\n \"express\": \"~3.0.0\"\n },\n \"devDependencies\": {},\n \"optionalDependencies\": {}\n}\n"
] |
{
"pile_set_name": "Github"
}
|
[
0
] | 0
| 5
|
[
"Arterial stiffness is an independent risk factor for cognitive impairment in the elderly: a pilot study.",
"\nLoss of cognitive function is a common condition in the elderly population. ",
"Cognitive impairment is defined as the transitional stage of cognitive decline, between normal aging and early dementia. ",
"We tested whether arterial stiffness, evaluated as pulse wave velocity (PWV), is associated with cognitive impairment in older subjects, and whether PWV is increased at a comparable extent in older subjects with cortical or subcortical cerebral lesions when compared with age-matched controls referred for memory deficits. ",
"Eighty-four subjects (78 +/- 5 years, 30 men and 54 women) referred for memory deficit with no history of stroke or atrial fibrillation were studied. ",
"Carotid-femoral PWV was determined non-invasively with Complior. ",
"The Mini Mental State Examination was assessed as a measure of global cognitive function. ",
"The sum of the score on the Activities of Daily Living and Instrumental Activities of Daily Living scales was used as a measure of personal independency. ",
"Based upon brain imaging, subjects were classified as referred for memory deficits with normal brain imaging, or control, with subcortical microvascular lesions or with cortical atrophy. ",
"PWV, normalized for mean blood pressure, was inversely correlated with the Mini Mental State Examination (r = -0.26, P < 0.05), even after controlling for education, prevalent cardiovascular (CV) disease, CV risk factors, and medication use (beta coefficient = -0.28, P < 0.01). ",
"PWV was also inversely correlated with personal independency (r = -0.36, P < 0.01; beta coefficient = -0.38, P < 0.01, after multiple adjustment). ",
"In the presence of no significant differences in age, education, traditional CV risk factor levels, carotid plaques, or prevalence of CV disease, higher PWV values were more frequent in subjects with cortical atrophy than in patients with subcortical microvascular lesions or controls (P < 0.05). ",
"PWV was associated with cognitive impairment and with a greater personal dependency, independently of major modifiable CV risk factors."
] |
{
"pile_set_name": "PubMed Abstracts"
}
|
[
0,
0,
0,
0.006191950464396285,
0,
0.03076923076923077,
0.011111111111111112,
0.006493506493506494,
0,
0.007168458781362007,
0.02040816326530612,
0.003367003367003367,
0.007407407407407408
] | 0.007147
| 5
|
[
"Early College High School Initiative - This is the Web site of the national initiative sponsored by the Bill and Melinda Gates Foundation, with support from the Carnegie Corporation of New York, the Ford Foundation and the W.K. Kellogg Foundation. ",
"This site provides links to reports, data and the partners around the country that are implementing early college high schools.",
"\n..."
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0.024193548387096774,
0,
0
] | 0.008065
| 5
|
[
"Q:\n\nDo users like getting form 'we received your message' emails?",
"\n\nI'm wondering if there has been research into whether users actually enjoy receiving those 'We got your email' type of responses from support requests or feedback forms. ",
"I find it irritating personally, but I realize I could be in the minority.",
"\n\nA:\n\nThis type of system behaviour is an implementation of a Feedback Loop, which is key for interaction design.",
"\nIn Seductive Interaction Design, Stephen Anderson summarises: \n\nWe like to know that our actions are influencing the world in some way, that our actions cause reaction - cause and effect.",
"\n\nIn this specific case, you can argue that a sufficient feedback loop would be to display an on-screen message saying: \"We have recorded your request and will get back to you in due course.\"",
"\nHowever, confirmation emails have some additional benefits:\n\nThey serve as a receipt (or a proof), including date and ideally the content of the request. ",
"These can be highly useful for further communication with the business. ",
"For instance, I don't have an email showing when did I ask my power company to join my electricity and gas bills - despite this happening some 6 months ago; so every time I call I have to approximate the time, which reduces my credibility.",
"\nIt assures the user that the email address they have provided is correct.",
"\nThe email is used by some as a follow-up reminder.",
"\nIn the strict development sense, many customer-service/fault-tracking packages send emails with a unique ID in the subject, facilitating further communication with the business via email exchange.",
"\n\nYou can make an analogy here to a launderette receipt - would you prefer the owner to just tell you \"It's alright Sir - I've got your name and telephone in my books; no need for a receipt. ",
"Just come back on Wednesday\"?",
"\n\nHaving said that, none of this may apply in your situation, and the benefit of such emails may outweigh the cost (of users having to deal with these emails).",
"\nLike receipts, if your reckon there may be too many too frequently, offer your users the option to opt out. ",
"Doing so would also answer your question - as you will have analytics regarding how many people, like you, find it unnecessary.",
"\n\n"
] |
{
"pile_set_name": "StackExchange"
}
|
[
0,
0,
0,
0.008849557522123894,
0.010638297872340425,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
] | 0.001083
| 5
|
[
"Media playback is unsupported on your device Media caption The chancellor says Britain could still leave the EU without a deal\n\nThe chancellor has promised \"a significant economic policy response\" in the event of a no-deal Brexit.",
"\n\nSajid Javid did not give details, but the BBC's Norman Smith said it could mean tax cuts to help mitigate the potential impact.",
"\n\nMr Javid is setting out plans for infrastructure investment on the second day of the Tory conference.",
"\n\nBut the event has so far been overshadowed by claims Boris Johnson touched a female journalist's thigh.",
"\n\nThe allegation - which the PM has denied - relates to a lunch in 1999 when Mr Johnson was the editor of the Spectator magazine.",
"\n\nMeanwhile, as the Tories gather in Manchester other MPs will be in Westminster after they voted down a motion to grant a three-day recess to cover the conference, and opposition parties were expected to meet to discuss their next moves on Brexit.",
"\n\nShadow health secretary Jon Ashworth told BBC Radio 4's Today programme they were \"prepared and ready in Parliament to respond to anything that comes out of Downing Street\".",
"\n\nThe SNP has also said the party wants to look at the possibility of holding a no confidence vote in the government this week.",
"\n\nThe theme of the conference in Manchester is \"Get Brexit Done\" and Mr Javid insisted the UK would be leaving the EU on 31 October - with or without a deal.",
"\n\nThat is despite a law - the Benn Act - being passed by MPs which stipulates that the government must ask for an extension to the Brexit deadline if a deal is not agreed by 19 October.",
"\n\nThe chancellor said the government had been working on \"mitigations\" which mean \"we will be able to deal with many of the disruptions\" of a no-deal if agreement cannot be reached with the bloc before the deadline.",
"\n\nHe said he would give more detail in his speech later, but told BBC Radio 4's Today programme: \"I'm clear that if it was no deal there would be a significant economic policy response.",
"\n\n\"You have the independent Bank of England that will almost certainly think about a monetary policy response and that's for them.",
"\n\n\"I will be thinking about a fiscal and other economic policy response.\"",
"\n\nBut Mr Javid admitted he was not sure how much a no-deal Brexit would cost the economy in the short-term, saying: \"I don't think anyone really knows a full proper answer to that question.\"",
"\n\nElsewhere, the Scottish Conservatives' interim leader Jackson Carlaw said the party would not support a further delay to Brexit and had dropped the opposition to no-deal advanced by his predecessor Ruth Davidson.",
"\n\n'Deeply concerning'\n\nThe Tories have so far made spending vows of more than £50bn at their conference.",
"\n\nThat includes an announcement later of £25bn for England's roads as well as £5bn for ultrafast broadband in some of the UK's \"hardest to reach parts\".",
"\n\nThe conference comes after a stormy week for their leader Mr Johnson - including allegations about his links to a US businesswoman and culminating on Sunday in the accusations by journalist Charlotte Edwardes.",
"\n\nOn BBC Breakfast, Mr Javid refused to comment on the \"personal allegations\" against the PM, adding: \"I have full faith in the prime minister and I don't doubt that and what he has said for a second.\"",
"\n\nHowever, former cabinet minister Justine Greening told Today the allegations were \"deeply concerning\".",
"\n\nHealth Secretary Matt Hancock told Channel 4 News he knew Ms Edwardes well and she was \"trustworthy\".",
"\n\nImage copyright Getty Images\n\nThe banners that dangle from the conference hall ceiling here tell a story.",
"\n\nInvest, invest, invest they say - in schools, the NHS and the police. ",
"In other words, spend, spend, spend.",
"\n\nWhat a contrast with a few years ago, when the focus was on cuts.",
"\n\nThe Conservatives argue that is because the public finances can now support a new approach.",
"\n\nBut vast uncertainty still swirls around Brexit - and what it might mean for the national balance sheet.",
"\n\nSince the start of this conference, the party has fleshed out details on how it will spend more than £50bn.",
"\n\nChancellor Sajid Javid will later make his contribution to this tally with promises on roads, buses and broadband.",
"\n\nThe chancellor will say the full benefits of his infrastructure investment \"may not be felt for some time\", but \"the work must start here and now\".",
"\n\nThe £25bn pot had already been set aside provisionally by his predecessor, Philip Hammond, but Mr Javid will confirm it will be spent on upgrades for 14 of England's major roads, including:\n\nCompleting the dualling of the A66 Trans-Pennine expressway and the A46 Newark bypass\n\nImproving the M60 Simister Island interchange in Manchester\n\nStarting construction on the A428 to improve journeys between Cambridge and Milton Keynes and widening the A12 in east England\n\nAt least £5bn will also be set aside to maintain and renew other strategic roads between 2020 and 2025.",
"\n\nThe chancellor will renew a pledge made earlier this month to invest £220m into improved bus services in England, including £50m for the country's first all-electric bus town or city.",
"\n\nAnd he will set a goal for contactless payments to be made available on every city bus.",
"\n\nPlans for so-called superbus networks, where local authorities will invest in bus lanes in exchange for more services from operators, will also be announced. ",
"A pilot is planned for Cornwall in 2020.",
"\n\nImage copyright PA Media\n\nOther promises unveiled on Monday include:\n\nA £5bn investment to support the roll-out of gigabit-capable internet, and mobile networks - including 5G.\n\nAn ambition to connect the hardest-to-reach 20% of the country - upping the earlier target of 10% - but a deadline to reach this goal has not been confirmed.",
"\n\nA pledge by Housing Secretary Robert Jenrick to give tenants in new housing association properties the right to shared ownership of their home.",
"\n\nPlans to create a simpler planning system to speed up the building of new homes.",
"\n\nLabour's shadow chancellor, John McDonnell, accused the Tories of only offering \"a combination of re-announcements and damp squibs\".",
"\n\nHe added the announcements showed \"the real difference between the parties\" with the Tories were \"tinkering around the edges, while Labour was proposing a fundamental shift of power and wealth from the few to the many\"."
] |
{
"pile_set_name": "OpenWebText2"
}
|
[
0.008695652173913044,
0.015503875968992248,
0.009708737864077669,
0.009523809523809525,
0.007751937984496124,
0.004032258064516129,
0.017142857142857144,
0.007874015748031496,
0.01910828025477707,
0.005405405405405406,
0,
0.005405405405405406,
0.007692307692307693,
0,
0.010526315789473684,
0.014018691588785047,
0,
0,
0.009478672985781991,
0.009950248756218905,
0.009615384615384616,
0.02912621359223301,
0.009345794392523364,
0.013888888888888888,
0,
0,
0,
0.009433962264150943,
0,
0,
0,
0.01048951048951049,
0,
0,
0.00625,
0.025,
0.002967359050445104,
0.013793103448275862,
0,
0.007462686567164179,
0
] | 0.007297
| 5
|
[
"Subscribe To\n\nWednesday, January 8, 2014\n\nThe Genealogy Night of the Living Dead Revisited?",
"\n\nThis notice appears on the startup page for New.FamilySearch.org. ",
"It says:\n\nUse FamilySearch Family Tree!",
"\n\nUpdates can no longer be made from new.FamilySearch.org. ",
"Please use the FamilySearch Family Tree, which adds powerful tools for data accuracy, usability, and collaboration.",
"Updates can no longer be made from new.FamilySearch.org. ",
"Please use the FamilySearch Family Tree, which adds powerful tools for data accuracy, usability, and collaboration.",
"\n\nHowever, a blogger in an email to me claims that the site is only mostly dead:\n\nI have found that new.familysearch.org is not strictly read-only, When I make a change to a name, date or place, I was surprised to still see that change reflected in new.familysearch.org. ",
"Using Ancestral Quest I can still see other variations of names, dates and places that are hidden in Family Tree and I can still \"reset the summary\" to the most correct information, substantiated by the sources I find.",
"\n\nWell, assuming this is correct, the statement on New.FamilySearch.org might still be correct. ",
"As an attorney I would probably say something like, the statement says \"Updates can no longer be made from new.familysearch.org.\" ",
"This says nothing about updates made from third-party programs such as Ancestral Quest...and so forth and so forth.",
"\n\nSo is New.FamilySearch.org really READ ONLY or is it only mostly READ ONLY?",
"\n\nI spent some time poking around in New.FamilySearch.org directly and it does appear to be more than mostly dead. ",
"I could see all the data, but none of the links to make changes worked at all. ",
"Anyone else out there finding this backdoor to the program still open? ",
"I went into Ancestral Quest and tried to make a change to a record in New.FamilySearch.org and I could not. ",
"So, I am not sure what the commentator is talking about.",
"\n\n8 comments:\n\nThe relationship between n.FS and FS-Family Tree is complicated. ",
"Presently a pretty anonymous entity identified only as \"FamilySearch\" is migrating family data from n.FS to FS-FT. ",
"In an unknown number of intances this is not just adding data, but reconfiguring families. ",
"Some users have discovered that errors they've fixed more than once are being reconstituted by \"FamilySearch\" more than once in the past couple of weeks.",
"\n\nI am the one who previously mentioned that I can still 'reset the summary', now called ‘select Family Tree Values’ in new.familysearch.org and Family Tree using Ancestral Quest. ",
"I tried it again just now, changing Simeon Lorenzo Holcomb to Simeon L. Holcume then back again to Simeon Lorenzo Holcomb. ",
"His ID # is LHPH-Y4Y. I can change birth & death information too and these changes appear in Family Tree as well as in new.familysearch.org.",
"\n\nTo see alternate data from new.familysearch.org that is hidden in Family Tree and ‘reset the summary’ or ‘select Family Tree Values’,\n\nI go to the person in my Ancestral Quest file, Highlight that person then Use the CTRL + E shortcut to see that person in Family Tree.through AQI then click on 'import from nFS' then I click on the drop down arrows next to name, birth & death so I can check all the submitted names, dates & places.",
"\n\nI often find complete dates and places in nFS that are hidden in Family Tree. ",
"When I find better data that is hidden in Family Tree, and substantiated by sources, I select the best data and ‘select Family Tree Values’ so the hidden information becomes available in Family Tree. ",
"It also appears in the Summary view in nFS. ",
"I am using version 14.00.17 of Ancestral Quest. ",
"I hope that is clearer.",
"\n\nThanks for your very detailed explanation. ",
"I think that making New.FamilySearch.org read only had a very limited effect on the problems we are experiencing due to the common database between NFS and FSFT.",
"\n\nAs I understand it from various blog posts, Family Tree and New Family Search databases are still linked and sync with each other. ",
"If you make a correction in Family Tree, the summary in New Family Search changes to that new value. ",
"I wonder if the commentator is really working directly with New Family Search or if he just doesn't realize that the changes are occurring via Family Tree?"
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0,
0.014705882352941176,
0,
0.01694915254237288,
0,
0.017543859649122806,
0,
0.007380073800738007,
0,
0.010416666666666666,
0.007692307692307693,
0.008695652173913044,
0.012987012987012988,
0.008695652173913044,
0.012658227848101266,
0,
0.018518518518518517,
0,
0,
0.008695652173913044,
0,
0,
0.016666666666666666,
0.024390243902439025,
0.014285714285714285,
0.004597701149425287,
0,
0.005,
0,
0.020833333333333332,
0,
0,
0.018633540372670808,
0.007518796992481203,
0.019801980198019802,
0.012903225806451613
] | 0.008044
| 5
|
[
"The role of delamination in failure of fibre-reinforced composites.",
"\nThe mechanisms by which delamination contributes to the failure of fibre-reinforced composites are reviewed. ",
"Through-thickness failure owing to interlaminar stresses is considered first, and the effect of delamination in impact and compression after impact. ",
"The way in which in-plane failure can occur by delamination and matrix cracks joining up to produce a fracture surface without the need to break fibres is considered next. ",
"Examples of quasi-isotropic laminates loaded at different off-axis angles, and with different numbers and thicknesses of ply blocks show large differences in unnotched tensile strength controlled by delamination from the free edge. ",
"Similar mechanisms determine the strength of notched specimens and give rise to the hole size effect, whereby tensile strength increases with decreasing hole diameter owing to increased delamination and splitting. ",
"Open hole tension and over-height compact tension tests with constant in-plane dimensions show a transition in failure mode with increasing ply block thickness from fibre-dominated fracture to complete delamination. ",
"In all these cases, the critical factor controlling strength is the relative propensity to delaminate."
] |
{
"pile_set_name": "PubMed Abstracts"
}
|
[
0,
0,
0,
0,
0,
0,
0,
0
] | 0
| 5
|
[
"902 shares\n\n\n\n\n\n\n\nKofi Kingston is currently experiencing the biggest push of his career, though this isn’t the first time he was on the verge of receiving main event status. ",
"In 2010, he was heavily favored to win the Money in the Bank ladder match at WrestleMania 26. ",
"WWE was pushing him massively during this time and it all seemed to be coming together for him until a botched spot in a match had a livid Randy Orton put an end to all that.",
"\n\nKofi Kingston was signed to a WWE developmental contract with less than a year of wrestling under his belt.",
"\n\nAfter graduating from Boston College in 2005, Kofi Nahaje Sarkodie-Mensah began pursuing his dream to become a professional wrestler. ",
"He began training at the tail-end of 2005, and by 2006, he was making independent wrestling appearances in the New England area. ",
"He made a big splash in a short period of time and by September of that year, with less than a year of wrestling under his belt, he signed a developmental contract with World Wrestling Entertainment.",
"\n\nOriginally wrestling under the name Kofi Nahaje Kingston, he would drop his middle name and arrive on the WWE scene in December of 2007.",
"\n\nVignettes started airing on the ECW brand hyping his debut. ",
"During this introduction phase, his videos, the official website, and commentators noted he would be the first Jamaican to wrestle for WWE. ",
"In actuality, he doesn’t have any Jamaican ancestry, nor any connection to Jamaica. ",
"He is, however, the first African-born performer in WWE history having been born in Kumasi, Ghana.",
"\n\nKingston was very different from the many rising stars of the time. ",
"Alongside his good look and persona, he had amazing charisma that attracted the audience with his high flying move-set.",
"\n\nWrestling undefeated for many months under the ECW brand, Kofi suffered his first loss as a single’s competitor by Shelton Benjamin in May of 2008. ",
"A month later, as part of WWE’s Supplemental Draft, Kingston was drafted to the Raw brand.",
"\n\nKofi Kingston was the first African-born wrestler to hold a championship in WWE\n\nIn his first match as a member of the Raw roster and first championship match in WWE, Kofi Kingston defeated Chris Jericho for the Intercontinental Championship at Night of Champions after some outside interference by Shawn Michaels. ",
"This win made him the first African-born wrestler to hold a championship in World Wrestling Entertainment.",
"\n\nFast forwarding to 2009, Kofi made his first of many appearances in the Royal Rumble. ",
"He only lasted seven minutes, being eliminated by The Brian Kendrick, but he made a strong impact. ",
"He qualified to compete in the Raw Elimination Chamber match for the World Heavyweight Championship at the No Way Out pay-per-view that took place on February 15, 2009. ",
"Edge, however, had other plans to win the World Heavyweight Championship that night and viciously attacked Kofi before the match, taking away his rightfully earned place in the match. ",
"As a consolation prize, Kofi was able to capture the United States Championship for his efforts.",
"\n\nKofi had an amazing summer of 2009 defending his US Championship with dignity and honor, something that Legacy (Randy Orton, Cody Rhodes, Ted Dibiase) knew nothing about in storyline. ",
"During this period, Kofi dropped his Jamaican accent and started evolving his character into a more serious role.",
"\n\nOn October 25, 2009, at the Bragging Rights pay-per-view, Randy Orton was defending his WWE Championship against John Cena in a 60-minute Iron Man match. ",
"Kofi, sick and tired of Legacy’s selfish ways and constant defiance of the rules, decided to come to the aid of Cena. ",
"In doing so, Kofi cost Orton the championship and Cena prevailed and won the match. ",
"Orton blamed Kofi for the loss and was hell-bent on revenge.",
"\n\nOn the very next night on Raw, Orton was seething and completely upset with Kofi and immediately attacked him after his match with Chris Jericho. ",
"This kickstarted a hot feud with Orton for the remainder of 2009.",
"\n\nLater that night in a backstage segment, Kofi boldly poured paint on Orton’s brand new car which was a gift from DiBiase. ",
"This ultimately took Orton’s rage to a breaking point which culminated when Hall of Famer Roddy “Rowdy” Piper came to Raw six days before 2009’s Survivor Series pay-per-view. ",
"Orton took this opportunity to punt Piper’s skull, but before the “Viper” could strike and let out his frustrations on a hapless Piper, Kofi came to the rescue.",
"\n\nIn what has been hailed as Kofi’s shining moment, Kofi Kingston and Randy Orton brawled all over the MSG arena in a match that took place on November 16, 2009. ",
"Kofi delivered his signature “Boom Drop” from the rafters onto Orton through a production table! ",
"This was the moment WWE officials finally looked at Kofi as their next huge star.",
"\n\nWatch Kofi Kingston create a career-defining moment, delivering a “Boom Drop” from the rafters onto Randy Orton through a production table on November 16, 2009’s edition of Monday Night Raw:\n\nAt Survivor Series that year, Kofi shocked the world when he eliminated both Punk and Orton in the closing moments of their 5-on-5 elimination match. ",
"Within the span of a minute, Kofi had defeated two former world champions, making a huge name for himself in the process. ",
"This win catapulted his career and the sky was the limit for Kofi– or so we thought?",
"\n\nThe heated rivalry between Kofi and Orton wasn’t finished by a long shot as for the remainder of 2009 they bested each other by picking up subsequent wins. ",
"Their rubber match would take place during December 13, 2009’s TLC pay-per-view in a show-stealing performance by Kofi. ",
"Orton eventually won the match and a rematch was issued for the next night on Raw. ",
"Even though Kofi didn’t topple his adversary, his strong push wasn’t completely over yet.",
"\n\nRandy Orton was noticeably upset and kept on screaming at Kofi, “Stupid! ",
"Stupid!”",
"\n\nKofi was penciled in to win the Money in the Bank Ladder match at WrestleMania 26. ",
"But on Monday Night Raw during a triple threat match against John Cena and Randy Orton in January 2010, all of that changed.",
"\n\nOrton gave Kofi the RKO to earn the pinfall, but after delivering the move, something seemed off. ",
"Randy was noticeably upset and kept on screaming at Kofi, “Stupid! ",
"Stupid!”",
"\n\nWe would later learn that Kofi botched the finish of the match which angered Orton. ",
"Kofi was supposed to stay down and Orton was to deliver his patented “punt” kick to Kingston’s head, however, Kofi got up too soon and Orton had to improvise. ",
"While Orton was pounding his fists in coiled position for his RKO finisher you can audibly hear him yelling, “You fucked up!” ",
"to Kofi. ",
"This highly insulted Orton and led to real-life heat between the two.",
"\n\nThis marked the end of Kofi’s push to the main event.",
"\n\nKofi was nowhere to be seen in the Money in the Bank ladder match, and in the weeks and months that followed, Kofi saw very little television time and was consistently booked to lose.",
"\n\nRelated: How Randy Orton Got Mr. Kennedy Fired from WWE\n\nIt’s fitting that Kofi Kingston’s current rise to the top coincided with him conquering the man that ended his push nine years before.",
"\n\n2019 would mark the first time Kofi would be given a shot at the WWE Championship since having that opportunity taken away from him in 2010. ",
"In a fitting nod to the past, Kofi’s current rise to the top coincided with him conquering the man that once ended his push in the first place. ",
"There was a moment during a match on SmackDown that took place on February 19, 2019, where Kofi referenced back to Orton’s mini-meltdown in 2010 by calling Orton, “Stupid! ",
"Stupid!” ",
"It was a poetic callback and payback nine years in the making!",
"\n\nMany roadblocks to the championship have been put in Kofi’s way in storyline (and in real life) and getting to this point has not been easy. ",
"So while Kofi battles his way to championship gold this coming Sunday (at the time of this writing) at WrestleMania 35, we look back and remember the hardships he had to face along the way. ",
"Every dog has its day and Kofi Kingston has proven his worth to shine at the top.",
"\n\nFollow us: Twitter / Facebook / Instagram\n\nThe Pro Wrestling Stories Podcast - your favorite stories, in the form of audio!"
] |
{
"pile_set_name": "OpenWebText2"
}
|
[
0.005714285714285714,
0.010638297872340425,
0.011494252873563218,
0.01834862385321101,
0.014705882352941176,
0,
0.005025125628140704,
0.014492753623188406,
0.016129032258064516,
0.007142857142857143,
0,
0.01020408163265306,
0,
0,
0.02,
0.03333333333333333,
0.025236593059936908,
0.009433962264150943,
0.011363636363636364,
0.010101010101010102,
0.005917159763313609,
0.005434782608695652,
0.010416666666666666,
0.021505376344086023,
0.008849557522123894,
0.019230769230769232,
0.01694915254237288,
0.023809523809523808,
0.03333333333333333,
0.02702702702702703,
0.015384615384615385,
0.024193548387096774,
0.005714285714285714,
0.01875,
0.024691358024691357,
0.020618556701030927,
0.024691358024691357,
0.014534883720930232,
0.00819672131147541,
0.011904761904761904,
0.012658227848101266,
0.016666666666666666,
0.024096385542168676,
0.011235955056179775,
0.02666666666666667,
0,
0.023529411764705882,
0.016129032258064516,
0.03,
0.029850746268656716,
0,
0.023255813953488372,
0.031446540880503145,
0.015873015873015872,
0.1111111111111111,
0.014492753623188406,
0.01818181818181818,
0.010810810810810811,
0.02072538860103627,
0.006993006993006993,
0.006944444444444444,
0.023255813953488372,
0,
0,
0.006993006993006993,
0.010526315789473684,
0.012345679012345678,
0
] | 0.01571
| 5
|
[
"Dictionary\n\nblock•ade\n\n—n.1. ",
"the isolating, closing off, or surrounding of a place, as a port, harbor, or city, by hostile ships or troops to prevent entrance or exit.",
"\n2. ",
"any obstruction of passage or progress: We had difficulty in getting through the blockade of bodyguards.3. ",
"Pathol.interruption or inhibition of a normal physiological signal, as a nerve impulse or a heart muscle–contraction impulse."
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0,
0,
0,
0,
0
] | 0
| 5
|
[
"Nicotrol NS\n\nInterested in a Discount on Nicotrol NS?",
"\n\nOur free DiscountRx savings card can help you and your family save money on your prescriptions. ",
"This card is accepted at all major chain pharmacies, nationwide. ",
"Enter your name and email address to receive your free savings card.",
"\n\nEnter Your Name\n\nEnter Your Email Address\n\nOur free DiscountRx savings card can help you and your family save money on your prescriptions. ",
"This card is accepted at all major chain pharmacies, nationwide. ",
"Enter your name and email address to receive your free savings card.",
"\n\nWhen and How to Use It\n\nSome general considerations to keep in mind during treatment with Nicotrol NS include the following:\n\nThis medication comes as a nasal spray. ",
"It is usually sprayed once or twice in each nostril every hour.",
"\n\nDo not use the nasal spray more than 5 times in one hour or 40 times in a day.",
"\n\nNicotrol NS should be used as a part of a complete quit-smoking program that includes support groups, counseling, or behavioral change strategies.",
"\n\nYou should avoid smoking, chewing tobacco, using snuff, or using any other nicotine products while you use this medication. ",
"Using more than one nicotine product increases your nicotine blood levels, increasing your risk for side effects.",
"\n\nThe nasal spray should be \"primed\" before the first use, and again if it is not used for 24 hours. ",
"To prime the medication, pump the bottle into a tissue until you see a fine spray. ",
"This usually takes six to eight pumps.",
"\n\nTo use Nicotrol NS, first blow your nose if it is not already clear. ",
"Then tilt your head back slightly, insert the tip of the bottle into your nose, and spray one time. ",
"Avoid sniffing, swallowing, or inhaling while spraying the medication, since the medication is absorbed through the lining of the nose. ",
"Repeat into the other nostril.",
"\n\nNicotrol NS comes with an information sheet explaining the proper way to use it. ",
"Read this sheet carefully before using this medication and each time you get your prescription filled. ",
"Ask your healthcare provider or pharmacist if you have any questions about how to use this product.",
"\n\neMedTV serves only as an informational resource. ",
"This site does not dispense medical advice or advice of any kind.",
"\nSite users seeking medical advice about their specific situation should consult with their own physician. ",
"Click\nTerms of Use for more information.",
"\n\nYou've chosen to add topics from the topic group to your selected topics.",
"\n\nAre you sure you want to add all of these topics?",
"\n\nAre You Sure?",
"\n\nYou've chosen to clear all of your selected topics. ",
"Remember, you need at least one selected topic to use HealthSavvy. ",
"If you choose this option, it cannot be undone, and you'll need to choose at least new topic to continue using your HealthSavvy programs."
] |
{
"pile_set_name": "Pile-CC"
}
|
[
0.018867924528301886,
0,
0,
0,
0,
0,
0,
0.005952380952380952,
0,
0,
0,
0,
0,
0,
0,
0,
0.014084507042253521,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0.014925373134328358,
0.0072992700729927005
] | 0.001852
| 5
|
[
"[Changes of echocardiographic data in auricular fibrillation of patients with rheumatic mitral valve defect].",
"\nEchocardiography was employed in 39 patients with rheumatic mitral valve disease and atrial fibrillation prior to and following electric defibrillation. ",
"Patients under 60 years of age, mainly those subjected to a surgical correction of the disease, with a history of fibrillation under 3 years and without signs of thromboembolic complications in the past were selected for sinus rhythm restoration. ",
"The peculiarities of echocardiograms in different frequency of the ventricular rhythm are described. ",
"A correlation was found between the end diastolic and stroke volumes and the duration of the diastole in the preceeding cycle. ",
"The relationship of the ejection fraction and of the heart contractions rate was demonstrated: in sudden rhythm accelerations in 2 successive cycles the ejection fraction decreases in the 3rd cycle, and in sudden rhythm decelerations it increases. ",
"The echocardiographic manifestations of mechanically ineffective systoles are described. ",
"Sinus rhythm was restored by defibrillation in 80% of the cases. ",
"The haemodynamic parameters prior to and following the elimination of cardiac fibrillation are presented. ",
"It is concluded that an echocardiographic enlargement of the left atrium over 60 mm is an unfavourable prognostic sign for sinus rhythm restoration."
] |
{
"pile_set_name": "PubMed Abstracts"
}
|
[
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
] | 0
| 5
|
[
"Introduction {#sec1}\n============\n\nGlioblastomas (GBMs; WHO grade IV glioma) are highly aggressive malignant primary adult brain tumors. ",
"Despite comprehensive treatment consisting of neurosurgical resection, high-dose radiation therapy (RT), and chemotherapy (temozolomide, TMZ), the median progression-free survival (PFS) remains 5--7 months ([@B1]). ",
"Given these poor results, there is an urgent need for improved therapy options. ",
"A potential therapeutic target is the family of histone deacetylases (HDACs) that comprises 18 different nuclear and cytoplasmic proteins primarily involved in modulating gene expression through epigenetic mechanisms but also having a broad impact on many additional pathways, including ones associated with cellular metabolism and cell cycle regulation ([@B2]--[@B4]). ",
"Several specific HDACs, particularly in class I and class II, show increased expression and are thought to contribute to oncogenesis in several types of cancer, including ones arising in breast, prostate, lung, and brain ([@B5]). ",
"As a result, the development of targeted HDAC inhibitors (HDACi) is an active research area for pharmacologic treatment of these diseases ([@B6]). ",
"In 2006, suberanilohydroxamic acid (SAHA), a first-generation HDACi which targets multiple class I and class II HDAC family members, became the first HDACi to receive FDA approval for advanced cutaneous T cell lymphomas ([@B7]). ",
"Preclinical investigations of SAHA have also shown antitumor effects in orthotopic glioma animal models ([@B8], [@B9]). ",
"This suggests that development of potent HDACis capable of penetrating the blood--brain barrier has the potential to improve therapeutic outcomes of patients with GBM. ",
"Research is ongoing into evaluating the synergistic effect of HDACi and chemoradiation for such patients ([@B10]).",
"\n\nBelinostat (PXD101, Spectrum Pharmaceuticals Inc., Irvine, CA), a new pan-HDACi that is structurally similar to SAHA, improves upon the former by having greater blood--brain barrier uptake, which may potentiate its use in the treatment of CNS tumors ([@B11], [@B12]). ",
"Belinostat received FDA approval for patients with relapsed/refractory peripheral T cell lymphoma in 2014 ([@B13]). ",
"In this work, we seek to show a translational analysis of belinostat in the treatment of GBM and describe how a quantitative imaging technique, proton spectroscopic magnetic resonance imaging (sMRI), can serve as a reliable imaging biomarker for monitoring therapy response of belinostat when combined with standard chemoradiation. ",
"First, we tested the antitumor effect of belinostat in an orthotopic rat glioma model. ",
"Second, we assessed the antidepression effect of belinostat in 2 well-known depression animal models. ",
"We also quantified the increase of mRNA levels of bottleneck enzymes for the production of myo-inositol (MI), myo-inositol phosphatase (MIP), an sMRI-detectable metabolite known to be associated with depression. ",
"Finally, we assessed the impact of belinostat in combination with chemoradiation in a human pilot study (ClinicalTrials.gov ID: NCT02137759) and present interim results for PFS and a survey of depressive symptomatology. ",
"We present sMRI and clinical data from patients in this study to evaluate the modality\\'s use in monitoring response to belinostat + chemoradiation. ",
"Our results show a statistically significant improvement of depressive symptoms with belinostat treatment, consistent with our animal data. ",
"These results support the utility of belinostat as an adjuvant therapy for GBM and sMRI as a quantitative imaging technique that can noninvasively monitor therapy response.",
"\n\nMethodology {#sec2}\n===========\n\nCell Culture and In Vitro HDACi Treatment {#sec2-1}\n-----------------------------------------\n\nBelinostat and other HDACis were dissolved in dimethyl sulfoxide (DMSO) to obtain a 100mM stock solution. ",
"A 9L rat glioma cell line was maintained in Dulbecco\\'s modified eagle medium (DMEM) (Mediatech Inc., Manassas, MA) supplemented with 10% fetal bovine serum and antibiotics at 37°C in 5% CO~2~. 9L cells were plated in 100-mm cell culture petri dishes. ",
"Cells were then treated 2 days following seeding with fresh medium containing various HDACis at concentrations of 1 μM for 12 h and were collected to prepare total RNA.",
"\n\nRNA Isolation, RT-PCR, and Real-Time RT-PCR {#sec2-2}\n-------------------------------------------\n\nCells were collected 12-hour postincubation; these cells underwent RNA isolation and reverse transcription-polymerase chain reaction (RT-PCR) to assess the total mRNA expression levels of the key enzymes in the synthesis of MI (MIP) ([@B8]). ",
"Total RNA was extracted from cultured cells following the manufacturer\\'s instructions as previously described ([@B14]). ",
"Primer sequences of MIP-1 were as follows: MIP-1 (GenBank accession number: [NM_016368](NM_016368)), 5′- AGCTGCATCGAGAACATCCT --3′ and 5′- GGGTACCGGTCCTTTCTTGT --3′; SYBR Green quantitative PCR reaction was carried out in a 15-μL reaction volume containing 2× PCR Master Mix (Applied Biosystems) per our previous reports ([@B14]).",
"\n\nAntitumor Effect in an In Vivo Rat Glioma Model {#sec2-3}\n-----------------------------------------------\n\nUsing a previously described orthotopic rat glioma model ([@B8]), the tumoricidal and psychological effects of belinostat were tested. ",
"9L rat glioma cells were stereotactically injected into the frontal lobes of male Fischer 344 rats (n = 9). ",
"At postinjection day 9, rats were treated with a daily intraperitoneal injection of either vehicle (10% DMSO, n = 1) or tiered doses of belinostat (n = 2 each of 25 mg/kg, 50 mg/kg, 75 mg/kg, and 100 mg/kg) for 4 days. ",
"Throughout the experiment, rats were monitored for mood behavior and activity levels using the volume of droppings as a surrogate measurement. ",
"Animals were sacrificed on postinjection day 12, and tumors were excised. ",
"This protocol was approved by the Institutional Animal Care and Use Committee (IACUC) at Emory University.",
"\n\nAntidepression Effect Assessment of Belinostat in 2 Animal Models {#sec2-4}\n-----------------------------------------------------------------\n\nAs described previously ([@B15]), the forced-swim test and tail suspension tests were used to assess the antidepression effect of belinostat. ",
"Five 6-week-old C57 black female mice were used in each group for forced-swim test and five 7-week-old NIH Swiss male mice were used in each group for tail suspension test. ",
"C57 black mice may not perform well in the tail suspension test owing to tail climbing behavior (<https://www.research.psu.edu/arp/experimental-guidelines/rodent-behavioral-tests-1/rodent-behavioral-tests.html>), whereas the NIH Swiss mice did not have similar issues. ",
"The forced-swim test was performed 6 h after belinostat treatment (75 mg/kg i.p.) ",
"in a 4-L beaker containing 3 L of tap water at a temperature of 25°C. ",
"Video tracking--based methods were used to record the duration of time spent \"immobile\" in the arena over 6 minutes (immobility measured between 2 and 8 minutes of a 10-minute trial; the extent of immobility correlates with levels of depression). ",
"Similarly, the tail suspension test is based on the fact that animals subjected to inescapable stress of being suspended by their tail for the short term, would develop an immobile posture ([@B16]). ",
"For the tail suspension test, the lipopolysaccharide (LPS)-induced depression model was used ([@B17]). ",
"Twenty-four hours after LPS administration (Sigma L3129; 0.85 mg/kg i.p.), ",
"the tail suspension test was performed. ",
"Video tracking--based methods were used to record the duration of time spent in immobility for 6 minutes.",
"\n\nClinical Study {#sec2-5}\n--------------\n\nPatients with newly diagnosed GBM were enrolled in either the control or treatment arm of an Institutional Review Board (IRB)-approved clinical trial at Emory University (ClinicalTrials.gov ID NCT02137759), wherein the treatment arm received intravenous belinostat (Spectrum Pharmaceuticals, Irvine, CA) as an investigational therapeutic. ",
"The study was not randomized, with patients serially enrolling into the control arm (in 2014--2015) followed by the belinostat treatment arm (in 2015--2018). ",
"All patients underwent maximal safe tumor resection, if resection was feasible, before enrolling in the study. ",
"Patients in both arms of the trial received standard-of-care therapy consisting of daily TMZ (75 mg/m^2^) × 42 days and focal radiation doses of 60 and 51 Gy to the resection cavity/residual contrast-enhancing tissue (per T1-weighted contrast-enhanced MRI postresection) and T2/FLAIR signal, respectively, in 30 fractions. ",
"Margins of 0.5--1.0 cm and 0.3--0.5 cm were added to the target volumes to generate the clinical treatment volume and planning treatment volume to account for microscopic disease spread and spatial uncertainty in treatment delivery ([@B18]). ",
"In the treatment arm, patients received daily intravenous doses of belinostat at either 500 or 750 mg/m^2^ for 5 consecutive days in 3 cycles, spaced 3 weeks apart beginning 1 week before the start of chemoradiation, as shown in [Figure 1](#F1){ref-type=\"fig\"}. ",
"The first 3 patients received a higher dose of belinostat. ",
"However, because 2 of the patients had serious adverse events with hematologic toxicity during the course of belinostat, TMZ, and radiation, the dose was lowered to 500 mg/m^2^ for the remaining patients in the trial.",
"\n\n{#F1}\n\nEach patient in the study underwent an sMRI scan prior to starting chemoradiation (week 1), after 2 weeks of chemoradiation (week 3), and 4 weeks after completing radiation (week 11). ",
"Patients in the treatment arm underwent an additional sMRI scan before starting the first week of belinostat (week 0). ",
"sMRI scans were conducted on a 3 T MR scanner (Siemens TimTrio or Siemens PRISMA with 32 channel head coil, Siemens Healthineers, Erlangen, Germany) using an echo planar spectroscopic imaging (EPSI) sequence combined with generalized autocalibrating partially parallel acquisition (GRAPPA), and metabolite maps were produced using the MIDAS software (University of Miami, Miami, FL) ([@B19], [@B20]). ",
"The metabolite maps were coregistered to a volumetric T1-weighted (T1w) MRI taken during the same scanning session with the patient in the same orientation. ",
"Longitudinal scans on the 4 patients were coregistered and brought into the first scan (week 0/1) imaging space using rigid registration. ",
"After each sMRI scan, the patient completed the Inventory of Depressive Symptomatology Self Report (IDS-SR), a validated 30-question survey designed to assess depressive symptoms ([@B21], [@B22]).",
"\n\nEPSI/GRAPPA sequence parameters were optimized to enhance the signal of choline (Cho, a metabolite involved in the synthesis of the phospholipid cell membrane and increased in tumors) and NAA (a healthy neuronal marker decreased as neoplasia invades into and destroys neuronal tissue). ",
"Patients were followed-up with standard-of-care imaging (contrast-enhanced T1-weighted MRI, CE-T1w MRI; fluid attenuation inversion recovery, FLAIR) for 12 months post-treatment or until progression of disease was confirmed by neuroradiologist. ",
"A total of 26 patients (13 control, 13 treatment) were enrolled at Emory University; of these, 3 did not complete the treatment protocol (1 in control arm, 2 in belinostat arm), and 2 did not undergo surgical resection of tumor (only underwent a biopsy for diagnosis). ",
"These 5 patients are excluded from analysis (see online Supplemental Figure 1). ",
"PFS is reported for patients based on time to radiologic confirmation of disease progression (per CE-T1w MRI) from the date of surgery. ",
"Data are right-censored for patients who have no known disease progression or were lost to follow-up. ",
"Sample cases from each arm of the study are shown to show the ability of sMRI to identify early response to treatment. ",
"Because follow-up data are continuing to be collected for patients in the treatment arm of the study, statistical analyses of the full data will be presented in future work.",
"\n\nResults {#sec3}\n=======\n\nAntitumor Effect of Belinostat in an Orthotopic Rat Model {#sec3-1}\n---------------------------------------------------------\n\nIn [Figure 2](#F2){ref-type=\"fig\"}, photographs of the 9 rats evaluated in this experiment are shown in their cage at pretreatment with belinostat and at day 13, 4 days after treatment, when the rats were sacrificed. ",
"The volume of animal droppings seen in the cage is used as a surrogate measure of activity and normal physiology. ",
"Rats showed decreased movement and grooming, measures of mood, before treatment with belinostat. ",
"The restoration of activity and improved mood was observed in a dose-dependent manner, with normal levels observed in rats treated with the highest 2 doses (75 mg/kg and 100 mg/kg). ",
"Photographs of the tumor in situ and excised are also shown in [Figure 2](#F2){ref-type=\"fig\"}, showing a similar dose-dependent decrease in tumor volume from untreated mice through the increasing doses of belinostat.",
"\n\n{#F2}\n\nAntidepression Effect of Belinostat in 2 Animal Models {#sec3-2}\n------------------------------------------------------\n\n[Figure 3](#F3){ref-type=\"fig\"} shows the results of the forced-swim and tail suspension tests. ",
"In the forced-swim test, the mice who received belinostat spent less time immobile compared to the control mice (*P* = .14). ",
"In the tail suspension test, the mice who received LPS + belinostat had a statistically significant decrease in immobility compared with mice who received LPS alone (*P* = .02).",
"\n\n{#F3}\n\nIn Vitro Study of mRNA Expression {#sec3-3}\n---------------------------------\n\nmRNA expression levels of MIP (a bottleneck enzyme in the production of MI) from HDACi-treated cells are shown in online Supplemental Figure 2 as fold-increases in log-scale compared with those of the untreated cells (DMSO vehicle control). ",
"Belinostat showed greater increases in restoration of mRNA levels at the same concentration as other HDACi, including SAHA. ",
"The only other HDACi which achieved greater efficacy is quisinostat (JNJ26481585, Janssen Pharmaceuticals, Beerse, Belgium), a second-generation pan-HDACi, which was being tested in phase II clinical trials for multiple myeloma ([@B23]). ",
"However, currently there are no active trials for quisinostat on ClinicalTrials.gov.",
"\n\nClinical Study {#sec3-4}\n--------------\n\nIn total, 21 patients who met inclusion criteria for analysis were assessed to determine differences in PFS between the 2 arms (see online Supplemental Figure 1). ",
"A table summarizing basic demographics of the 2 arms of the clinical study is shown in [Figure 4A](#F4){ref-type=\"fig\"}. ",
"Both arms showed similar distributions of known genetic targets that improve response to radiation---mutation of isocitrate dehydrogenase 1 (IDH1) and promoter methylation of the gene for O ([@B6])-methylguanine-DNA methyltransferase ([@B24]). [",
"Figure 4B](#F4){ref-type=\"fig\"} shows Kaplan--Meier curves for PFS from date of surgery (tick marks indicate time of censoring). ",
"Six-month PFS was 73% for the control arm and 100% for the belinostat arm. ",
"A log-rank test assessing PFS data up to 6 months trended toward statistical significance (*P* = .09). ",
"No statistically significant difference was observed on a log-rank test assessing PFS data up to 12 months (*P* = .45). ",
"Of these 21 patients, 17 completed an IDS-SR survey at both baseline (week 0 for belinostat arm, week 1 for control arm) and at week 11 (see online Supplemental Figure 2; [Table 1](#T1){ref-type=\"table\"}). ",
"While no significant difference in the scores was observed at either time point, the belinostat cohort had a statistically significant improvement in scores over the course of treatment using a 2-tailed unpaired *T* test (*P* = .04).",
"\n\n{#F4}\n\n###### \n\nIDS-SR Assessment\n\n Control Belinostat *P value*\n -------------------- ------------- ------------- -----------\n Number of Patients 10 7 \n Baseline Score 18.2 ± 9.1 22.0 ± 9.8 0.43\n Week 11 Score 22.3 ± 10.9 16.1 ± 15.5 0.39\n Change in Score 4.1 ± 9.7 −5.9 ± 8.7 0.04\n\nThe IDS-SR assessment of patients in both study arms between baseline and 1-month post-RT shows a statistically significant improvement in assessment scores for patients who received belinostat. *",
"P* values indicate results of a two-tailed unpaired *t*-test.",
"\n\n[Figures 5](#F5){ref-type=\"fig\"} and [6](#F6){ref-type=\"fig\"} depict sMRI and clinical CE-T1w MRI scans for 2 representative patients, 1 from each of the study arms. ",
"At baseline, both patients showed elevated choline metabolism (red arrows) around the resection cavities, indicating the presence of increased cellular turnover associated with neoplasia. ",
"One-month post-RT (week 11), both patients showed decreased levels of choline compared with baseline, and low NAA levels owing to subsequent radiation damage to in-field neurons. ",
"Therefore, Cho/NAA did not reliably indicate early response (see online Supplemental Figure 3); however, we found that peritumoral MI was improved in the subject who received belinostat (see online Supplemental Figure 3) at 1-month post-RT. ",
"The control patient ([Figure 5](#F5){ref-type=\"fig\"}) was deemed to have potential progression of her disease because of the thickened contrast enhancement around the resection cavity on CE-T1w imaging; a month later, however, the thickened contrast rim was gone, and the patient was deemed to not yet have disease progression. ",
"The patient in the belinostat arm ([Figure 6](#F6){ref-type=\"fig\"}) had a similar course; only the increase in enhancement occurred 3 months after radiation was completed.",
"\n\n{#F5}\n\n{#F6}\n\nDiscussion {#sec4}\n==========\n\nIn this work, we sought to characterize the antitumor and antidepressant activity of belinostat, a new HDACi with improved brain penetration, in a translational manner: starting from in vivo animal glioma models to testing in patients with glioblastoma. ",
"First, we assessed the efficacy of belinostat in reducing tumor volume in an orthotopic rat glioma model. ",
"Here, a dose-dependent reduction in tumor size was observed, suggesting the antitumor properties of the drug are effective in crossing the blood--brain barrier in vivo ([Figure 2](#F2){ref-type=\"fig\"}). ",
"In addition, it was observed that the activity levels of rats, as measured by grooming activities and droppings, were higher in those treated with increased doses of belinostat. ",
"These improvements are consistent with previously reported literature by Covington et al. ([",
"@B25]) that HDACis possess antidepressant properties. ",
"To further assess the antidepressive effect of belinostat, we subjected mice to 2 different models of induced depression. ",
"We found that belinostat reduced the immobility time in both the forced-swim and tail suspension tests ([Figure 3](#F3){ref-type=\"fig\"}), exhibiting the drug\\'s antidepressant effect. ",
"We followed these tests with an in vitro assessment of belinostat\\'s effect on MIP, the key enzyme in the production of MI that was implicated in depression. ",
"The in vitro cell study showed that belinostat had greater restorative activity for MIP than most other HDACi. ",
"An HDACi tested that had higher restoration than belinostat was quisinostat (JNJ26481585); however, there is no clinical trial currently enrolling patients testing quisinostat. ",
"As such, belinostat shows promise as a targeted HDACi for glioblastoma because of its increased uptake into the brain and its efficacy in restoring key metabolic activity for depression.",
"\n\nThe belinostat clinical trial completed enrollment of patients in August 2018, and patients are continuing to be followed to assess long-term outcomes including progression-free and overall survival. ",
"Although statistical claims cannot yet be made regarding long-term survival and efficacy, a comparison of 6-month PFS and initial changes in mood are presented in this work. ",
"The cohort receiving belinostat showed a trend of improved 6-month PFS compared to the control cohort (*P* = .09); however, this difference was mitigated by 12 months (*P* = .45). ",
"Despite a limited sample size for this study, these results suggest that belinostat may improve response to chemoradiation therapy as hypothesized. ",
"A speculated reason for the improved PFS at 6 months but not at 12 months is that belinostat was given to subjects for only a short term during RT.",
"\n\nWhile 6-month PFS outcomes approached statistical significance, the belinostat cohort did achieve a statistically significant improvement in depression as measured by the IDS-SR (*P* = 0.04). ",
"This suggests that the mood improvement effect of belinostat, as shown in our animal data and with the claim by Covington et al. ([",
"@B25]), may translate to humans. ",
"These preliminary data suggest future large cohorts to be evaluated.",
"\n\nFinally, this study showed the potential of sMRI as a noninvasive monitoring tool for investigational therapeutics. ",
"As shown in [Figures 5](#F5){ref-type=\"fig\"} and [6](#F6){ref-type=\"fig\"}, both patients appeared to have a reduced tumor burden when assessing choline metabolism at week 1, 1 month after the completion of RT. ",
"Owing to radiation-induced damage, NAA was reduced around the high dose area, which made Cho/NAA ineffective in assessing tumor response (see online Supplemental Figure 3). ",
"MI showed a slight improvement back towards normal level at the 1-month post-RT scan in the patient treated with belinostat, consistent with IDS-SR score improvement (see online Supplemental Figure 3). ",
"Further studies, including longitudinal scanning, are needed to fully elucidate the timeline of metabolite changes in these patients. ",
"Standard imaging, however, differed between the 2 patients and suggested that the control patient may have been experiencing disease progression, when eventually it turned out to be stable disease at that time. ",
"This is a phenomenon known as pseudoprogression, the ambiguity of CE-T1w findings in differentiating true progression of disease from normal tissue response to high-dose radiation. ",
"sMRI, however, is robust to the pseudoprogression phenomenon, as the modality is measuring endogenous intracellular metabolism rather than vasculature damages/changes or tissue phenomena such as edema. ",
"Both patients showed similar metabolic signatures, which turned out to be more accurate of the underlying pathology compared to clinical imaging.",
"\n\nConclusion {#sec5}\n==========\n\nIn this work we described the therapeutic and antitumor, antidepression effects of belinostat, a potent pan-HDACi with blood--brain barrier permeability through: a rat glioma model, 2 mouse depression models, an in vitro cell study, and testing in a pilot clinical study in patients with glioblastoma. ",
"The results from this work suggest that belinostat may be an effective HDACi at delaying disease progression and improving depression. ",
"Furthermore, it shows that the treatment response can be monitored noninvasively using spectroscopic MRI during pseudoprogression period. ",
"Further studies and analysis of the ongoing clinical trial may yield a better understanding of the role that HDACis play in the metabolic profiles of GBM and motivate the development of better, targeted therapies for patients with this debilitating disease.",
"\n\nAdditional testing of this drug in human subjects can help with separating this improved mood/activity effect due to a primary property of HDACis from improvement as a secondary effect to reduced tumor burden.",
"\n\nSupplemental Materials {#sm1}\n----------------------\n\nAbbreviations: HDACiHistone deacetylase inhibitorsGBMglioblastomaPFSprogression-free survivalRTradiation therapyTMZtemozolomideHDACshistone deacetylasesSAHAsuberanilohydroxamic acidsMRIspectroscopic magnetic resonance imagingMImyo-inositolMIPmyo-inositol phosphataseDMSOdimethyl sulfoxideDMEMDulbecco\\'s modified eagle mediumLPSlipopolysaccharideEPSIecho planar spectroscopic imagingT1wT1-weightedIDS-SRInventory of Depressive Symptomatology Self Report\n\nWe would like to thank Spectrum Pharmaceuticals for providing the investigational drug used in this clinical study; the staff at the Clinical Trials Office at the Winship Cancer Institute for their support and assistance with recruiting and managing the patients enrolled in the clinical study; and Dr. Andrew Maudsley and Mr. Sulaiman Sheriff at the University of Miami for their support with the EPSI sequence and MIDAS software framework. ",
"Funding for this work came from National Institutes of Health grant U01CA172027.",
"\n\nDisclosures: No disclosures to report.",
"\n\nConflict of Interest: The authors have no conflict of interest to declare.",
"\n"
] |
{
"pile_set_name": "PubMed Central"
}
|
[
0.0072992700729927005,
0.013953488372093023,
0,
0.005405405405405406,
0.008695652173913044,
0.006802721088435374,
0.021834061135371178,
0.025,
0.005952380952380952,
0.008771929824561403,
0.022222222222222223,
0.017241379310344827,
0.0030120481927710845,
0,
0,
0.0047169811320754715,
0.004545454545454545,
0,
0,
0.005813953488372093,
0,
0.011904761904761904,
0.005952380952380952,
0.014577259475218658,
0.01652892561983471,
0.01818181818181818,
0.004098360655737705,
0,
0,
0,
0,
0.018867924528301886,
0.006968641114982578,
0.011560693641618497,
0.011152416356877323,
0,
0,
0,
0.005025125628140704,
0.009708737864077669,
0.013333333333333334,
0,
0,
0.013089005235602094,
0,
0,
0.006191950464396285,
0.004132231404958678,
0,
0,
0.004608294930875576,
0,
0.007936507936507936,
0,
0,
0.0199501246882793,
0,
0,
0.02040816326530612,
0.006944444444444444,
0,
0.0037174721189591076,
0,
0.007352941176470588,
0,
0,
0,
0,
0,
0,
0,
0.004608294930875576,
0,
0.002457002457002457,
0,
0.011299435028248588,
0,
0,
0.008264462809917356,
0.005208333333333333,
0.008064516129032258,
0.008403361344537815,
0,
0.0048543689320388345,
0,
0.00816326530612245,
0.015503875968992248,
0,
0.009708737864077669,
0.008333333333333333,
0.0048543689320388345,
0,
0,
0.011363636363636364,
0.011111111111111112,
0.001455604075691412,
0,
0,
0,
0.0111731843575419,
0.008298755186721992,
0,
0,
0,
0,
0,
0,
0,
0.010638297872340425,
0.0022624434389140274,
0,
0,
0,
0.010869565217391304,
0.018518518518518517,
0,
0,
0.012658227848101266,
0.009009009009009009,
0.005649717514124294,
0,
0,
0,
0,
0,
0.013605442176870748,
0.005154639175257732,
0.007633587786259542,
0.030303030303030304,
0,
0,
0,
0.011560693641618497,
0.0049504950495049506,
0,
0,
0,
0,
0,
0,
0,
0,
0.0038910505836575876,
0,
0.007345225603357817,
0.0125,
0,
0,
0
] | 0.004786
| 5
|
[
"In the second of his series of essays on Baudrillard, Andrew Robinson examines how the French thinker saw 'symbolic exchange' giving way to capitalist alienation, and discusses Baudrillard's intriguing proposition that alienation stems from the social exclusion of death.",
"\n\nBy Andy McLaverty-Robinson\n\nIn the first part of his 14-part introduction to Baudrillard, political theorist Andrew Robinson explored the French thinker’s concept of ‘symbolic exchange’ as the basis for a non-alienated social life. ",
"In this second part, Robinson examines how Baudrillard saw symbolic exchange giving way to capitalist alienation, and discusses Baudrillard’s intriguing proposition that alienation stems from the social exclusion of death.",
"\n\n\n\nThe passage to capitalism\n\nSymbolic exchange – or rather, its suppression – plays a central role in the emergence of capitalism. ",
"Baudrillard sees a change happening over time. ",
"Regimes based on symbolic exchange (differences are exchangeable and related) are replaced by regimes based on equivalence (everything is, or means, the same). ",
"Ceremony gives way to spectacle, immanence to transcendence.",
"\n\nBaudrillard’s view of capitalism is derived from Marx’s analysis of value. ",
"Baudrillard accepts Marx’s view that capitalism is based on a general equivalent. ",
"Money is the general equivalent because it can be exchanged for any commodity. ",
"In turn, it expresses the value of abstract labour-time. ",
"Abstract labour-time is itself an effect of the regimenting of processes of life, so that different kinds of labour can be compared.",
"\n\nCapitalism is derived from the autonomisation or separation of economics from the rest of life. ",
"It turns economics into the ‘reality-principle’. ",
"It is a kind of sorcery, connected in some way to the disavowed symbolic level. ",
"It subtly shifts the social world from an exchange of death with the Other to an eternal return of the Same.",
"\n\nCapitalism functions by reducing everything to a regime based on value and the production of value. ",
"To be accepted by capital, something must contribute value. ",
"This creates an immense regime of social exchange. ",
"However, this social exchange has little in common with symbolic exchange. ",
"It ultimately depends on the mark of value itself being unexchangeable. ",
"Capital must be endlessly accumulated. ",
"States must not collapse. ",
"Capitalism thus introduces the irreversible into social life, by means of accumulation.",
"\n\nAccording to Baudrillard, capitalism rests on an obsession with the abolition of death. ",
"Capitalism tries to abolish death through accumulation. ",
"It tries to ward off ambivalence (associated with death) through value (associated with life). ",
"But this is bound to fail. ",
"General equivalence – the basis of capitalism – is itself the ever-presence of death. ",
"The more the system runs from death, the more it places everyone in solitude, facing their own death. ",
"Life itself is fundamentally ambivalent. ",
"The attempt to abolish death through fixed value is itself deathly.",
"\n\nAccumulation also spreads to other fields. ",
"The idea of progress, and linear time, comes from the accumulation of time, and of stockpiles of the past. ",
"The idea of truth comes from the accumulation of scientific knowledge. ",
"Biology rests on the separation of living and non-living. ",
"According to Baudrillard, such accumulations are now in crisis. ",
"For instance, the accumulation of the past is undermined, because historical objects now have to be concealed to be preserved – otherwise they will be destroyed by excessive consumption. ",
"Value is produced from the residue or remainder of an incomplete symbolic exchange. ",
"The repressed, market value, and sign-value all come from this remainder. ",
"To destroy the remainder would be to destroy value.",
"\n\nCapitalist exchange is always based on negotiation, even when it is violent. ",
"The symbolic order does not know this kind of equivalential exchange or calculation. ",
"And capitalist extraction is always one-way. ",
"It amounts to a non-reversible aggression in which one act (of dominating or killing) cannot be returned by the other.",
"\n\nIt is also this regime which produces scarcity – Baudrillard here endorses Sahlins’ argument. ",
"Capitalism produces the Freudian “death drive”, which is actually an effect of the capitalist culture of death. ",
"For Baudrillard, the limit to both Marx and Freud is that they fail to theorise the separation of the domains they study – the economy and the unconscious. ",
"It is the separation which grounds their functioning, which therefore only occurs under the regime of the code.",
"\n\nBaudrillard also criticises theories of desire, including those of Deleuze, Foucault, Freud and Lacan. ",
"He believes desire comes into existence based on repression. ",
"It is an effect of the denial of the symbolic. ",
"Liberated energies always leave a new remainder; they do not escape the basis of the unconscious in the remainder. ",
"Baudrillard argues that indigenous groups do not claim to live naturally or by their desires – they simply claim to live in societies. ",
"This social life is an effect of the symbolic. ",
"Baudrillard therefore criticises the view that human liberation can come about through the liberation of desire. ",
"He thinks that such a liberation will keep certain elements of the repression of desire active.",
"\n\nBaudrillard argues that the processes which operate collectively in indigenous groups are repressed into the unconscious in metropolitan societies. ",
"This leads to the autonomy of the psyche as a separate sphere. ",
"It is only after this repression has occurred that a politics of desire becomes conceivable. ",
"He professes broad agreement with the Deleuzian project of unbinding energies from fixed categories and encouraging flows and intensities. ",
"However, he is concerned that capitalism can recuperate such releases of energy, disconnecting them so they can eventually reconnect to it. ",
"Unbinding and drifting are not fatal to capitalism, because capitalism itself unbinds things, and re-binds things which are unbound. ",
"What is fatal to it is, rather, reversibility.",
"\n\nCapitalism continues to be haunted by the forces it has repressed. ",
"Separation does not destroy the remainder. ",
"Quite the opposite. ",
"The remainder continues to exist, and gains power from its repression. ",
"This turns the double or shadow into something unquiet, vampiric, and threatening. ",
"It becomes an image of the forgotten dead. ",
"Anything which reminds us of the repressed aspects excluded from the subject is experienced as uncanny and threatening. ",
"It becomes the ‘obscene’, which is present in excess over the ‘scene’ of what is imagined.",
"\n\nThis is different from theories of lack, such as the Lacanian Real. ",
"Baudrillard’s remainder is an excess rather than a lack. ",
"It is the carrier of the force of symbolic exchange.",
"\n\nModern culture dreams of radical difference. ",
"The reason for this is that it exterminated radical difference by simulating it. ",
"The energy of production, the unconscious, and signification all in fact come from the repressed remainder. ",
"Our culture is dead from having broken the pact with monstrosity, with radical difference.",
"\n\nThe West continues to perpetrate genocide on indigenous groups. ",
"But for Baudrillard, it did the same thing to itself first – destroying its own indigenous logics of symbolic exchange. ",
"Indigenous groups have also increasingly lost the symbolic dimension, as modern forms of life have been imported or imposed. ",
"This according to Baudrillard produces chronic confusion and instability.",
"\n\nGift-exchange is radically subversive of the system. ",
"This is not because it is rebellious. ",
"Baudrillard thinks the system can survive defections or exodus. ",
"It is because it counterposes a different ‘principle of sociality’ to that of the dominant system. ",
"According to Baudrillard, the mediations of capitalism exist so that nobody has the opportunity to offer a symbolic challenge or an irreversible gift. ",
"They exist to keep the symbolic at bay. ",
"The affective charge of death remains present among the oppressed, but not with the ‘properly symbolic rhythm’ of immediate retaliation.",
"\n\nThe Church and State also exist based on the elimination of symbolic exchange. ",
"Baudrillard is highly critical of Christianity for what he takes to be a cult of suffering, solitude and death. ",
"He sees the Church as central to the destruction of earlier forms of community based on symbolic exchange.",
"\n\nBaudrillard seems to think that earlier forms of the state and capitalism retained some degree of symbolic exchange, but in an alienated, partially repressed form. ",
"For instance, the imaginary of the ‘social contract’ was based on the idea of a sacrifice – this time of liberty for the common good. ",
"In psychoanalysis, symbolic exchange is displaced onto the relationship to the master-signifier. ",
"I haven’t seen Baudrillard say it directly, but the impression he gives is that this is a distorted, authoritarian imitation of the original symbolic exchange. ",
"Nonetheless, it retains some of its intensity and energy. ",
"Art, theatre and language have worked to maintain a minimum of ceremonial power.",
"\n\nIt is the reason older orders did not suffer the particular malaise of the present. ",
"It is easy to read certain passages in Baudrillard as if he is bemoaning the loss of these kinds of strong significations. ",
"This is initially how I read Baudrillard’s work. ",
"But on closer inspection, this seems to be a misreading. ",
"Baudrillard is nostalgic for repression only to the extent that the repressed continued to carry symbolic force as a referential. ",
"He is nostalgic for the return of symbolic exchange, as an aspect of diffuse, autonomous, dis-alienated social groups.",
"\n\nDeath\n\nDeath plays a central role in Baudrillard’s theory, and is closely related to symbolic exchange. ",
"According to Baudrillard, what we have lost above all in the transition to alienated society is the ability to engage in exchanges with death.",
"\n\nDeath should not be seen here in purely literal terms. ",
"Baudrillard specifies early on that he does not mean an event affecting a body, but rather, a form which destroys the determinacy of the subject and of value – which returns things to a state of indeterminacy. ",
"Baudrillard certainly discusses actual deaths, risk-taking, suicide and so on. ",
"But he also sees death figuratively, in relation to the decomposition of existing relations, the “death” of the self-image or ego, the interchangeability of processes of life across different categories. ",
"For instance, eroticism or sexuality is related to death, because it leads to fusion and communication between bodies. ",
"Sexual reproduction carries shades of death because one generation replaces another. ",
"Baudrillard’s concept of death is thus quite similar to Bakhtin’s concept of the grotesque. ",
"Death refers to metamorphosis, reversibility, unexpected mutations, social change, subjective transformation, as well as physical death.",
"\n\nAccording to Baudrillard, indigenous groups see death as social, not natural or biological. ",
"They see it as an effect of an adversarial will, which they must absorb. ",
"And they mark it with feasting and rituals. ",
"This is a way of preventing death from becoming an event which does not signify. ",
"Such a non-signifying event is absolute disorder from the standpoint of symbolic exchange. ",
"For Baudrillard, the west’s idea of a biological, material death is actually an idealist illusion, ignoring the sociality of death.",
"\n\nPoststructuralists generally maintain that the problems of the present are rooted in the splitting of life into binary oppositions. ",
"For Baudrillard, the division between life and death is the original, founding opposition on which the others are founded. ",
"After this first split, a whole series of others have been created, confining particular groups – the “mad”, prisoners, children, the old, sexual minorities, women and so on – to particular segregated situations. ",
"The definition of the ‘normal human’ has been narrowed over time. ",
"Today, nearly everyone belongs to one or another marked or deviant category.",
"\n\nThe original exclusion was of the dead – it is defined as abnormal to be dead. “",
"You livies hate us deadies”. ",
"This first split and exclusion forms the basis, or archetype, for all the other splits and exclusions – along lines of gender, disability, species, class, and so on.",
"\n\nThis discrimination against the dead brings into being the modern experience of death. ",
"Baudrillard suggests that death as we know it does not exist outside of this separation between living and dead. ",
"The modern view of death is constructed on the model of the machine and the function. ",
"A machine either functions or it does not. ",
"The human body is treated as a machine which similarly, either functions or does not. ",
"For Baudrillard, this misunderstands the nature of life and death.",
"\n\nThe modern view of death is also necessitated by the rise of subjectivity. ",
"The subject needs a beginning and an end, so as to be reducible to the story it tells. ",
"This requires an idea of death as an end. ",
"It is counterposed to the immortality of social institutions. ",
"In relation to individuals, ideas of religious immortality is simply an ideological cover for the real exclusion of the dead. ",
"But institutions try to remain truly immortal. ",
"Modern systems, especially bureaucracies, no longer know how to die – or how to do anything but keep reproducing themselves.",
"\n\nThe internalisation of the idea of the subject or the soul alienates us from our bodies, voices and so on. ",
"It creates a split, as Stirner would say, between the category of ‘man’ and the ‘un-man’, the real self irreducible to such categories. ",
"It also individualises people, by destroying their actual connections to others. ",
"The symbolic haunts the code as the threat of its own death. ",
"The society of the code works constantly to ward off the danger of irruptions of the symbolic.",
"\n\nThe mortal body is actually an effect of the split introduced by the foreclosure of death. ",
"The split never actually stops exchanges across the categories. ",
"In the case of death, we still ‘exchange’ with the dead through our own deaths and our anxiety about death. ",
"We no longer have living, mortal relationships with objects either. ",
"They are reduced to the instrumental. ",
"It is as if we have a transparent veil between us.",
"\n\nSymbolic exchange is based on a game, with game-like rules. ",
"When this disappears, laws and the state are invented to take their place. ",
"It is the process of excluding, marking, or barring which allows concentrated or transcendental power to come into existence. ",
"Through splits, people turn the other into their ‘imaginary’. ",
"For instance, westerners invest the “Third World” with racist fantasies and revolutionary aspirations; the “Third World” invests the west with aspirational fantasies of development. ",
"In separation, the other exists only as an imaginary object. ",
"Yet the resultant purity is illusory. ",
"For Baudrillard, any such marking or barring of the other brings the other to the core of society. “",
"We all” become dead, or mad, or prisoners, and so on, through their exclusion.",
"\n\nThe goal of ‘survival’ is fundamental to the birth of power. ",
"Social control emerges when the union of the living and the dead is shattered, and the dead become prohibited. ",
"The social repression of death grounds the repressive socialisation of life. ",
"People are compelled to survive so as to become useful. ",
"For Baudrillard, capitalism’s original relationship to death has historically been concealed by the system of production, and its ends. ",
"It only becomes fully visible now this system is collapsing, and production is reduced to operation.",
"\n\nIn modern societies, death is made invisible, denied, and placed outside society. ",
"For example, elderly people are excluded from society. ",
"People no longer expect their own death. ",
"As a result, it becomes unintelligible. ",
"It keeps returning as ‘nature which will not abide by objective laws’. ",
"It can no longer be absorbed through ritual. ",
"Western society is arranged so death is never done by someone else, but always attributable to ‘nature’.",
"\n\nThis creates a bureaucratic, judicial regime of death, of which the concentration camp is the ultimate symbol. ",
"The system now commands that we must not die – at least not in any old way. ",
"We may only die if law and medicine allow it. ",
"Hence for instance the spread of health and safety regulations. ",
"On the other hand, murder and violence are legalised, provided they can be re-converted into economic value. ",
"Baudrillard sees this as a regressive redistribution of death. ",
"It is wrested from the circuit of social exchanges and vested in centralised agencies.",
"\n\nFor Baudrillard, there is not a social improvement here. ",
"People are effectively being killed, or left to die, by a process which never treats them as having value. ",
"On the other hand, even when capitalism becomes permissive, inclusive and tolerant, it still creates an underlying anxiety about being reduced to the status of an object or a marionette. ",
"This appears as a constant fear of being manipulated. ",
"The slave remains within the master’s dialectic for as long as ‘his’ life or death serves the reproduction of domination.",
"\n\nA fatal ontology?",
"\n\nIn Fatal Strategies, Baudrillard suggests an ontology which backs up his analysis of death. ",
"The world itself is committed to extremes and to radical antagonism. ",
"It is bored of meaning. ",
"There is an ‘evil genie’, a principle of Evil which constantly returns in the form of seduction. ",
"Historical processes are really pushed forward by this principle. ",
"All energy comes from fission and rupture. ",
"These cannot be replaced by production or mechanical processes. ",
"There is no possibility of a collective project or a coherent society, only the operation of such forces. ",
"Every order exists only to be transgressed and dismantled.",
"\n\nThe world is fundamentally unreal. ",
"This leads to a necessity of irony, which is to say, the slippage of meaning. ",
"Historically, the symbolic was confined to the metaphysical. ",
"It did not affect the physical world. ",
"But with the rise of models, with the physical world derived increasingly from the code, the physical world is brought within the symbolic. ",
"It becomes reversible. ",
"The rational principle of linear causality collapses. ",
"The world is, and always remains, enigmatic.",
"\n\nPeople will give for seduction or for simulation what they would never give for quality of life. ",
"Advertising, fashion, gambling and so on liberate ‘immoral energies’ which hark back to the magical or archaic gamble on the power of thought against the power of reality. ",
"Neoliberalism is in some ways an ultimate release of such diabolical forces. ",
"People will look for an ecstatic excess of anything – even boredom or oppression.",
"\n\nIn this account, the principle of evil becomes the only fixed point. ",
"Desire is not inescapable. ",
"What is inescapable is the object and its seduction, its ‘principle of evil’. ",
"The object at once submits to law and breaks it in practice, mocking it. ",
"Its own “game” cannot be discerned. ",
"It is a poor conductor of the symbolic order but a good conductor of signs. ",
"The drive towards spectacles, illusions and scenes is stronger than the desire for survival.",
"\n\n[Part three will be published next week. ",
"Click here for other essays in this series.]"
] |
{
"pile_set_name": "OpenWebText2"
}
|
[
0.007380073800738007,
0.008547008547008548,
0.0045045045045045045,
0,
0,
0,
0,
0.012987012987012988,
0.012195121951219513,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0.010416666666666666,
0,
0.00641025641025641,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0.025,
0,
0.024691358024691357,
0,
0.009433962264150943,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0.009433962264150943,
0,
0,
0,
0,
0,
0,
0,
0.010869565217391304,
0,
0,
0,
0,
0,
0,
0.007633587786259542,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0.008064516129032258,
0,
0.007352941176470588,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
] | 0.000757
| 5
|
[
"Jimmy Beasley\n\nJames Edward Beasley (born September 30, 1931) is an American rhythm and blues singer, pianist and songwriter.",
"\n\nBorn in Kansas City, Missouri, Beasley learned piano from Willie Rice, and was heavily influenced by Fats Domino. ",
" He was also a Golden Gloves winning amateur boxer, and sang in the Aces Quartet and the Sonny Kenner Trio. ",
" In 1954, he moved to Los Angeles, and joined King Perry's band, with whom he recorded for Hollywood Records. ",
" He also recorded under his own name for the Peacock and Modern labels, in a style similar to Fats Domino. ",
" \n\nAlthough Beasley had no national chart hits, \"Ella Jane\", recorded with a band that included saxophonists Maxwell Davis and Plas Johnson, and guitarist Rene Hall, sold moderately well, and Beasley regularly played in Los Angeles clubs. ",
" Some of Beasley's recordings on Modern, including \"Don't Feel Sorry for Me\" and \"Little Coquette\" were recorded in New Orleans in 1956 with Dave Bartholomew's band, and \"Little Coquette\" was later recorded by Fats Domino. ",
" Beasley also backed Etta James at recording sessions in New Orleans. ",
" \n\nAfter having a moderate regional hit with \"My Happiness\" in 1956, Beasley formed his own band and moved to New York City, where he worked for Alan Freed, performed alongside Ray Charles, Elvis Presley and Ruth Brown, appeared on numerous TV shows, and continued to write for Fats Domino and others. ",
" He continued to record for Modern and its subsidiary Crown label, who released an LP, Jimmy's House Party, which was repackaged in 1961 with a slightly different track listing as Twist with Jimmy Beasley. ",
" His last recordings, \"Ready To Go\" / \"My Baby's Gone\", were released in 1965. ",
" His records were among those that influenced the development of ska music in Jamaica. ",
"\n\nIn the 1970s, Beasley appeared in cabaret in Reno and Las Vegas, and regularly in Laughlin, Nevada. ",
" He then moved to Torrance, California, where he owned a club and continued to perform occasionally. ",
" He also appeared at blues festivals in Europe in the 1990s, but retired from performing after a stroke in the late 1990s.",
"\n\nReferences\n\nCategory:1931 births\nCategory:Living people\nCategory:American rhythm and blues musicians\nCategory:Musicians from Kansas City, Missouri"
] |
{
"pile_set_name": "Wikipedia (en)"
}
|
[
0.024,
0.02586206896551724,
0,
0.01818181818181818,
0.028037383177570093,
0.02092050209205021,
0.017937219730941704,
0.02857142857142857,
0.019867549668874173,
0.024271844660194174,
0,
0,
0.00980392156862745,
0,
0,
0
] | 0.013591
| 5
|
[
"Q:\n\nVBA: Nested For/Loop\n\nI am creating a macro that will copy all data from one workbook/multiple sheets into another workbook/multiple sheets. ",
" The first spreadsheet has 7 worksheets named as Sun-Sat. ",
" The second worksheet has 10 worksheets 3 worksheets are irrelevant and the other 7 worksheets are named Sunday-Saturday.",
"\nI tested each for loop separately and they work as needed. ",
" When trying to combine them the inner for statement repeats and cycles through all dates before backing out. ",
" I have tried incorporating a exit for to jump out of the inner for but when going back to the inner for it does not increment +1 to go to the next date. ",
" Is there a simple way to add +1 from the outer for statement?",
"\nenter code here\nDim wsShortDays, wsFullDays As Variant\nDim wsShortDaysCrnt, wsFullDaysCrnt As Long\nDim SD, FD As Long\n\nwsShortDays = Array(\"Sun\", \"Mon\", \"Tue\", \"Wed\", \"Thu\", \"Fri\", \"Sat\")\nwsFullDays = Array(\"Sunday\", \"Monday\", \"Tuesday\", \"Wednesday\", \"Thursday\", \"Friday\", \"Saturday\")\n\nFor FD = LBound(wsFullDays) To UBound(wsFullDays)\n With wbk1.Worksheets(wsFullDays(FD))\n\n For SD = LBound(wsShortDays) To UBound(wsShortDays)\n With wbk2.Worksheets(wsShortDays(SD))\n wbk2.Worksheets(wsShortDays(SD)).Activate\n Range(\"A:H\").Copy\n End With\n Exit For\n Next SD\n\n wbk1.Worksheets(wsFullDays(FD)).Activate\n Range(\"C:J\").PasteSpecial xlPasteAllUsingSourceTheme\n SD = 1\n End With\nNext FD\n\nA:\n\nYou do not need the inner loop as your arrays are synced just use the same reference number from the first loop. ",
" It will equate Sunday with Sun and so forth:\nDim wsShortDays As Variant, wsFullDays As Variant\nDim FD As Long\n\nwsShortDays = Array(\"Sun\", \"Mon\", \"Tue\", \"Wed\", \"Thu\", \"Fri\", \"Sat\")\nwsFullDays = Array(\"Sunday\", \"Monday\", \"Tuesday\", \"Wednesday\", \"Thursday\", \"Friday\", \"Saturday\")\n\nFor FD = LBound(wsFullDays) To UBound(wsFullDays)\n wbk2.Worksheets(wsShortDays(FD)).Range(\"A:H\").Copy\n wbk1.Worksheets(wsFullDays(FD)).Range(\"C:J\").PasteSpecial xlPasteAllUsingSourceTheme\nNext FD\n\n"
] |
{
"pile_set_name": "StackExchange"
}
|
[
0,
0,
0,
0,
0,
0,
0,
0.004424778761061947,
0.010416666666666666
] | 0.001649
| 5
|
[
"132 F.3d 41\nNOTICE: Ninth Circuit Rule 36-3 provides that dispositions other than opinions or orders designated for publication are not precedential and should not be cited except when relevant under the doctrines of law of the case, res judicata, or collateral estoppel.",
"UNITED STATES of America, Plaintiff-Appellee,v.Mauricio Antonio MARTINEZ-VALIENTE, Defendant-Appellant.",
"\nNo. ",
"97-10029.",
"\nUnited States Court of Appeals, Ninth Circuit.",
"\nSubmitted Dec. 8, 1997**Decided Dec. 10, 1997.",
"\n\nAppeal from the United States District Court for the Northern District of California Susan Illston, District Judge, Presiding\nBefore: BRIGHT,*** FLETCHER and T.G. NELSON, Circuit Judges.",
"\n\n\n1\nMEMORANDUM*\n\n\n2\nMartinez-Valiente, a native and citizen of El Salvador, appeals his conviction under 8 U.S.C. § 1326(b)(1) for illegal reentry after deportation following a felony conviction. ",
" Martinez-Valiente argues that he could not properly be convicted under § 1326(b)(1) because: 1) he was denied the right to attend the hearing at which his underlying deportation was ordered; and 2) he lacked the necessary intent to commit the offense under § 1326(b)(1) since he believed that his underlying deportation proceedings were invalid due to his absence. ",
" We affirm.",
"\n\nI. Deportation Hearing\n\n3\nMartinez-Valiente acknowledges that the lawfulness of a prior deportation is not an element of the offense under § 1326. ",
" See United States v. Alvarado-Delgado, 98 F.3d 492, 493 (9th Cir.1996) (en banc), cert. ",
"denied, 117 S.Ct. ",
"1096 (1997). ",
" However, citing United States v. Mendoza-Lopez, 481 U.S. 828 (1987), Martinez-Valiente argues that, because his deportation hearing was conducted in abstentia, it was so fundamentally unfair as to effectively deprive him of his right to appeal. ",
" Even so, Martinez-Valiente properly concedes that to challenge his prior deportation collaterally Ninth Circuit precedent requires him to prove prejudice as a result of the error. ",
" See Alvarado-Delgado, 98 F.3d at 493-94.",
"\n\n\n4\nNevertheless, Martinez-Valiente argues first that his absence from the hearing at which he was ordered deported was such a fundamental due process deprivation that prejudice should be presumed. ",
" However, Martinez-Valiente can cite no authority for this novel proposition that seems to subvert the prejudice requirement. ",
"he concedes is the clear law of this circuit.",
"\n\n\n5\nMartirnez-Valiente further argues that he was in fact prejudiced by his absence from the hearing because his ex-wife and children are U.S. citizens, because he could have benefitted from voluntary departure, and because he may have been able to make a claim for asylum. ",
" We disagree. ",
" Martinez-Valiente concedes that he himself is an alien. ",
" Moreover, because of his felony conviction, he was ineligible for favorable alternatives to deportation. ",
" Finally, Martinez-Valiente has not at any time alleged any facts that could support a claim for asylum. ",
" The district court did not err.",
"\n\nII. ",
"Intent\n\n6\nMartirez-Valiente acknowledges that § 1326 is not a specific intent crime. ",
" As such, under the clear precedent of this court and every other circuit but the Seventh, no reasonable belief defense is available against a charge of illegal reentry. ",
" See United States v. Leon-Leon, 35 F.3d 1428, 1432-33 (9th Cir.1994). ",
" Nevertheless, Martinez-Valiente urges this court to reconsider its rejection of the reasonable belief defense in light of his argument that, because he believed that his deportation was invalid, he did not have the necessary intent to commit the offense of illegal reentry under § 1326. ",
" We decline to do so.",
"\n\n\n7\nAFFIRMED.",
"\n\n\n\n**\n The panel unanimously finds this case suitable for decision without oral argument. ",
" Fed. ",
"R.App. ",
"P. 34(a) and Ninth Circuit Rule 34-4\n\n\n**\n * Honorable Myron H. Bright, Senior United States Circuit Judge for the Eighth Circuit Court of Appeals, sitting by designation\n\n\n*\n This disposition is not appropriate for publication and may not be cited to or by the courts of this circuit except as provided by 9th Cir. ",
" R. 36-3\n\n\n"
] |
{
"pile_set_name": "FreeLaw"
}
|
[
0,
0.02912621359223301,
0,
0,
0.0425531914893617,
0,
0.021164021164021163,
0.005076142131979695,
0,
0,
0.006711409395973154,
0.011235955056179775,
0,
0,
0.008130081300813009,
0.011049723756906077,
0.024390243902439025,
0.005025125628140704,
0.007936507936507936,
0,
0.0036363636363636364,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0,
0.16666666666666666,
0.14285714285714285,
0.012658227848101266,
0
] | 0.013111
| 5
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.